\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123622273:

Variant ID: vg0123622273 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23622273
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAACCTAAATGTACCCACTTTTTTGGCAACTATGTCAAAATTTTGGTAATTTGCCAAAATTTTGGCAGGATTTCTTATATAGTTACCAAAATTTG[G/A]
CAGCAAACTAAATGTACCCACTTTTTTTTGGTAACTTTACCAAAATTTGGTAAGGTTGAAAATGGCACAAAAGTAAACAGCCCCTAAGTTTAGTAATAAG

Reverse complement sequence

CTTATTACTAAACTTAGGGGCTGTTTACTTTTGTGCCATTTTCAACCTTACCAAATTTTGGTAAAGTTACCAAAAAAAAGTGGGTACATTTAGTTTGCTG[C/T]
CAAATTTTGGTAACTATATAAGAAATCCTGCCAAAATTTTGGCAAATTACCAAAATTTTGACATAGTTGCCAAAAAAGTGGGTACATTTAGGTTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 47.30% 2.43% 0.44% NA
All Indica  2759 38.50% 57.00% 3.81% 0.72% NA
All Japonica  1512 80.30% 19.10% 0.60% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 5.00% 87.60% 6.55% 0.84% NA
Indica II  465 39.80% 55.30% 3.87% 1.08% NA
Indica III  913 57.00% 41.70% 1.10% 0.22% NA
Indica Intermediate  786 41.60% 52.50% 4.83% 1.02% NA
Temperate Japonica  767 98.80% 0.70% 0.52% 0.00% NA
Tropical Japonica  504 60.50% 39.50% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 35.30% 2.07% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 63.30% 35.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123622273 G -> A LOC_Os01g41730.1 upstream_gene_variant ; 2016.0bp to feature; MODIFIER silent_mutation Average:47.458; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0123622273 G -> A LOC_Os01g41720-LOC_Os01g41730 intergenic_region ; MODIFIER silent_mutation Average:47.458; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0123622273 G -> DEL N N silent_mutation Average:47.458; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123622273 NA 4.89E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 7.84E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 1.36E-06 NA mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 4.42E-06 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 3.83E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 5.78E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 2.83E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 1.25E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 1.87E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 2.16E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 2.98E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 2.17E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 1.63E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 8.66E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 1.60E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 3.11E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622273 NA 1.31E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251