\
| Variant ID: vg0123593589 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 23593589 |
| Reference Allele: CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA | Alternative Allele: TTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA,C |
| Primary Allele: CTAGCATTTCTCACATTCAT ATTGATGTTAATGAATGTAA ATAGATATATATGTCTA | Secondary Allele: TTAGCATTTCTCACATTCAT ATTGATGTTAATGAATGTAA ATAGATATATATGTCTA |
Inferred Ancestral Allele: Not determined.
TACCTTGTCGATATCTTCTTGCTTCTCCTGCCAATTTATCCTGTAATCATTTGTCTTCCTTGGTATCTACTACTTCCTCCGTTTCACAATGTAAGTCATT[CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA/TTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA,C]
GATTCATTAATATCAATATGAATGTGAGAAATGTTAGAATGACTTACATTGTGAAACGAAGGGAATAGTATTTAACACAGCTAGTAGCTATAGGCCCTAT
ATAGGGCCTATAGCTACTAGCTGTGTTAAATACTATTCCCTTCGTTTCACAATGTAAGTCATTCTAACATTTCTCACATTCATATTGATATTAATGAATC[TAGACATATATATCTATTTACATTCATTAACATCAATATGAATGTGAGAAATGCTAG/TAGACATATATATCTATTTACATTCATTAACATCAATATGAATGTGAGAAATGCTAA,G]
AATGACTTACATTGTGAAACGGAGGAAGTAGTAGATACCAAGGAAGACAAATGATTACAGGATAAATTGGCAGGAGAAGCAAGAAGATATCGACAAGGTA
| Populations | Population Size | Frequency of CTAGCATTTCTCACATTCAT ATTGATGTTAATGAATGTAA ATAGATATATATGTCTA(primary allele) | Frequency of TTAGCATTTCTCACATTCAT ATTGATGTTAATGAATGTAA ATAGATATATATGTCTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 25.70% | 0.85% | 0.85% | C: 8.06% |
| All Indica | 2759 | 51.60% | 37.30% | 1.27% | 1.01% | C: 8.81% |
| All Japonica | 1512 | 83.80% | 9.80% | 0.13% | 0.00% | C: 6.28% |
| Aus | 269 | 92.60% | 2.20% | 0.00% | 4.46% | C: 0.74% |
| Indica I | 595 | 88.40% | 4.20% | 2.52% | 0.00% | C: 4.87% |
| Indica II | 465 | 58.50% | 37.60% | 1.29% | 0.65% | C: 1.94% |
| Indica III | 913 | 24.10% | 56.50% | 0.44% | 1.64% | C: 17.31% |
| Indica Intermediate | 786 | 51.50% | 39.90% | 1.27% | 1.27% | C: 5.98% |
| Temperate Japonica | 767 | 98.30% | 0.80% | 0.13% | 0.00% | C: 0.78% |
| Tropical Japonica | 504 | 62.70% | 24.00% | 0.00% | 0.00% | C: 13.29% |
| Japonica Intermediate | 241 | 81.70% | 8.70% | 0.41% | 0.00% | C: 9.13% |
| VI/Aromatic | 96 | 63.50% | 2.10% | 0.00% | 0.00% | C: 34.38% |
| Intermediate | 90 | 57.80% | 30.00% | 3.33% | 0.00% | C: 8.89% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> DEL | N | N | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> C | LOC_Os01g41670.1 | upstream_gene_variant ; 4712.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> C | LOC_Os01g41680.1 | upstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> C | LOC_Os01g41690.1 | upstream_gene_variant ; 1460.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> C | LOC_Os01g41680-LOC_Os01g41690 | intergenic_region ; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> TTAGCATTTCTCACATTCATATTGATGTTA ATGAATGTAAATAGATATATATGTCTA | LOC_Os01g41670.1 | upstream_gene_variant ; 4711.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> TTAGCATTTCTCACATTCATATTGATGTTA ATGAATGTAAATAGATATATATGTCTA | LOC_Os01g41680.1 | upstream_gene_variant ; 783.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> TTAGCATTTCTCACATTCATATTGATGTTA ATGAATGTAAATAGATATATATGTCTA | LOC_Os01g41690.1 | upstream_gene_variant ; 1461.0bp to feature; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0123593589 | CTAGCATTTCTCACATTCATATTGATGTTAATGAATGTAAATAGATATATATGTCTA -> TTAGCATTTCTCACATTCATATTGATGTTA ATGAATGTAAATAGATATATATGTCTA | LOC_Os01g41680-LOC_Os01g41690 | intergenic_region ; MODIFIER | silent_mutation | Average:73.72; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123593589 | NA | 5.75E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | 4.33E-06 | 4.51E-06 | mr1346 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | 5.31E-06 | 2.42E-06 | mr1456 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 2.61E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.60E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.36E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 9.89E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 2.79E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.86E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 7.30E-08 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 7.22E-06 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 2.26E-07 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 3.40E-08 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.29E-09 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.06E-09 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 9.75E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 8.23E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 5.64E-11 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 8.49E-10 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.89E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 2.55E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 8.71E-09 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 6.83E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 2.54E-10 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.90E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 1.26E-08 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123593589 | NA | 9.83E-09 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |