Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123560913:

Variant ID: vg0123560913 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23560913
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TGACGTCAAATTGTTCTTTAAGCATGACATAAATATTTTCATATTTACACCAAAAATTTGAATAAAACGAATGATCAAACGTTGGTTGAAAAGTCAACGG[C/T]
GTCATATATTAAAATACGGAGGGAGTAGTTGGAAAAATATTGAAAAGACAGCTGATAGCAATTAGCATGTTCATCAGGGCCACTCTTACCAACTTCCACC

Reverse complement sequence

GGTGGAAGTTGGTAAGAGTGGCCCTGATGAACATGCTAATTGCTATCAGCTGTCTTTTCAATATTTTTCCAACTACTCCCTCCGTATTTTAATATATGAC[G/A]
CCGTTGACTTTTCAACCAACGTTTGATCATTCGTTTTATTCAAATTTTTGGTGTAAATATGAAAATATTTATGTCATGCTTAAAGAACAATTTGACGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 38.60% 0.55% 0.02% NA
All Indica  2759 64.80% 34.70% 0.43% 0.04% NA
All Japonica  1512 46.70% 53.20% 0.07% 0.00% NA
Aus  269 95.50% 1.50% 2.97% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 62.60% 36.30% 0.86% 0.22% NA
Indica III  913 48.40% 51.30% 0.33% 0.00% NA
Indica Intermediate  786 61.50% 37.90% 0.64% 0.00% NA
Temperate Japonica  767 43.90% 56.10% 0.00% 0.00% NA
Tropical Japonica  504 43.30% 56.70% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 36.90% 0.41% 0.00% NA
VI/Aromatic  96 74.00% 24.00% 2.08% 0.00% NA
Intermediate  90 57.80% 38.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123560913 C -> T LOC_Os01g41610.1 upstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:73.811; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg0123560913 C -> T LOC_Os01g41610.2 upstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:73.811; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg0123560913 C -> T LOC_Os01g41620.1 downstream_gene_variant ; 792.0bp to feature; MODIFIER silent_mutation Average:73.811; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg0123560913 C -> T LOC_Os01g41610-LOC_Os01g41620 intergenic_region ; MODIFIER silent_mutation Average:73.811; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg0123560913 C -> DEL N N silent_mutation Average:73.811; most accessible tissue: Minghui63 root, score: 94.385 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123560913 C T -0.01 -0.01 -0.02 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123560913 NA 7.96E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 4.18E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 1.62E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 2.99E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 4.00E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 7.56E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 4.59E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 1.09E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 3.40E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 1.43E-10 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 6.03E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 3.86E-06 5.48E-06 mr1428_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 1.27E-06 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 3.47E-11 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 2.72E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 4.36E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 1.60E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 2.05E-10 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 4.69E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 6.88E-10 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123560913 NA 6.53E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251