\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123559524:

Variant ID: vg0123559524 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23559524
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATGATGCTCGATGCAATATCCTTATGTGTGGAGTTTTGATAAAAAACGGCAAAAAATTATTAGTAAATTGTAAATTTTCATTAGATTGGGTCAATAG[A/G]
AAATTCATGCTATCAAGGGGATGTTGCCTTGATATATAGGAATGAGAAAAGTGCTCAAAAGAGTTTTAGTTGAAGTGGTTCTCTTTCTTATATTTGTGTG

Reverse complement sequence

CACACAAATATAAGAAAGAGAACCACTTCAACTAAAACTCTTTTGAGCACTTTTCTCATTCCTATATATCAAGGCAACATCCCCTTGATAGCATGAATTT[T/C]
CTATTGACCCAATCTAATGAAAATTTACAATTTACTAATAATTTTTTGCCGTTTTTTATCAAAACTCCACACATAAGGATATTGCATCGAGCATCATCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 34.80% 0.51% 8.00% NA
All Indica  2759 58.00% 37.00% 0.54% 4.42% NA
All Japonica  1512 62.80% 36.80% 0.07% 0.33% NA
Aus  269 7.40% 3.00% 2.23% 87.36% NA
Indica I  595 95.80% 4.00% 0.00% 0.17% NA
Indica II  465 61.30% 37.40% 0.65% 0.65% NA
Indica III  913 35.40% 56.00% 0.33% 8.32% NA
Indica Intermediate  786 53.70% 39.80% 1.15% 5.34% NA
Temperate Japonica  767 69.50% 30.50% 0.00% 0.00% NA
Tropical Japonica  504 43.80% 56.00% 0.20% 0.00% NA
Japonica Intermediate  241 81.30% 16.60% 0.00% 2.07% NA
VI/Aromatic  96 64.60% 26.00% 0.00% 9.38% NA
Intermediate  90 50.00% 40.00% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123559524 A -> G LOC_Os01g41610.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:37.142; most accessible tissue: Callus, score: 67.985 N N N N
vg0123559524 A -> G LOC_Os01g41610.2 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:37.142; most accessible tissue: Callus, score: 67.985 N N N N
vg0123559524 A -> G LOC_Os01g41620.1 downstream_gene_variant ; 2181.0bp to feature; MODIFIER silent_mutation Average:37.142; most accessible tissue: Callus, score: 67.985 N N N N
vg0123559524 A -> G LOC_Os01g41610-LOC_Os01g41620 intergenic_region ; MODIFIER silent_mutation Average:37.142; most accessible tissue: Callus, score: 67.985 N N N N
vg0123559524 A -> DEL N N silent_mutation Average:37.142; most accessible tissue: Callus, score: 67.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123559524 NA 9.08E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 3.20E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 3.06E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 2.35E-06 NA mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 6.70E-06 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 3.10E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 8.95E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 9.18E-09 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 1.14E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 9.67E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 3.53E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 3.74E-09 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 1.29E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 6.35E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 1.09E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 8.51E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 1.37E-08 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 2.81E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 5.08E-08 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123559524 NA 7.99E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251