\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123548345:

Variant ID: vg0123548345 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23548345
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCCCCACCATCACTCTTAGCCCTAATTATTTTAATTGGTTGCACAGCAGCACGCAAAGTATCTGAACCAATAATTGCCACATCATCTAAGTCAATACC[A/G]
TCGACAATGTCTTGATGATCTGCATACAAAACAAATGATCTGACCCTAGGTACAAGAGCGACCATACTATTAGTGTCTGCATCACACTTAACCCTCCTCA

Reverse complement sequence

TGAGGAGGGTTAAGTGTGATGCAGACACTAATAGTATGGTCGCTCTTGTACCTAGGGTCAGATCATTTGTTTTGTATGCAGATCATCAAGACATTGTCGA[T/C]
GGTATTGACTTAGATGATGTGGCAATTATTGGTTCAGATACTTTGCGTGCTGCTGTGCAACCAATTAAAATAATTAGGGCTAAGAGTGATGGTGGGGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 21.50% 1.10% 27.61% NA
All Indica  2759 60.50% 0.90% 1.38% 37.22% NA
All Japonica  1512 37.00% 61.80% 0.13% 1.06% NA
Aus  269 7.80% 1.90% 3.35% 86.99% NA
Indica I  595 93.60% 0.00% 2.52% 3.87% NA
Indica II  465 63.70% 1.10% 0.86% 34.41% NA
Indica III  913 40.60% 0.40% 0.55% 58.38% NA
Indica Intermediate  786 56.60% 2.00% 1.78% 39.57% NA
Temperate Japonica  767 27.60% 72.20% 0.13% 0.00% NA
Tropical Japonica  504 42.30% 56.00% 0.20% 1.59% NA
Japonica Intermediate  241 56.00% 40.70% 0.00% 3.32% NA
VI/Aromatic  96 66.70% 24.00% 0.00% 9.38% NA
Intermediate  90 41.10% 34.40% 3.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123548345 A -> G LOC_Os01g41590.1 synonymous_variant ; p.Asp118Asp; LOW synonymous_codon Average:22.961; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0123548345 A -> DEL LOC_Os01g41590.1 N frameshift_variant Average:22.961; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123548345 NA 4.49E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 3.26E-09 mr1561 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 3.45E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 6.87E-06 6.86E-06 mr1996 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 5.14E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 4.22E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 1.22E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 6.44E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 1.71E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123548345 NA 2.54E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251