\
| Variant ID: vg0123548345 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23548345 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 80. )
TTTCCCCACCATCACTCTTAGCCCTAATTATTTTAATTGGTTGCACAGCAGCACGCAAAGTATCTGAACCAATAATTGCCACATCATCTAAGTCAATACC[A/G]
TCGACAATGTCTTGATGATCTGCATACAAAACAAATGATCTGACCCTAGGTACAAGAGCGACCATACTATTAGTGTCTGCATCACACTTAACCCTCCTCA
TGAGGAGGGTTAAGTGTGATGCAGACACTAATAGTATGGTCGCTCTTGTACCTAGGGTCAGATCATTTGTTTTGTATGCAGATCATCAAGACATTGTCGA[T/C]
GGTATTGACTTAGATGATGTGGCAATTATTGGTTCAGATACTTTGCGTGCTGCTGTGCAACCAATTAAAATAATTAGGGCTAAGAGTGATGGTGGGGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 21.50% | 1.10% | 27.61% | NA |
| All Indica | 2759 | 60.50% | 0.90% | 1.38% | 37.22% | NA |
| All Japonica | 1512 | 37.00% | 61.80% | 0.13% | 1.06% | NA |
| Aus | 269 | 7.80% | 1.90% | 3.35% | 86.99% | NA |
| Indica I | 595 | 93.60% | 0.00% | 2.52% | 3.87% | NA |
| Indica II | 465 | 63.70% | 1.10% | 0.86% | 34.41% | NA |
| Indica III | 913 | 40.60% | 0.40% | 0.55% | 58.38% | NA |
| Indica Intermediate | 786 | 56.60% | 2.00% | 1.78% | 39.57% | NA |
| Temperate Japonica | 767 | 27.60% | 72.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 42.30% | 56.00% | 0.20% | 1.59% | NA |
| Japonica Intermediate | 241 | 56.00% | 40.70% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 66.70% | 24.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 41.10% | 34.40% | 3.33% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123548345 | A -> G | LOC_Os01g41590.1 | synonymous_variant ; p.Asp118Asp; LOW | synonymous_codon | Average:22.961; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0123548345 | A -> DEL | LOC_Os01g41590.1 | N | frameshift_variant | Average:22.961; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123548345 | NA | 4.49E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 3.26E-09 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 3.45E-07 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | 6.87E-06 | 6.86E-06 | mr1996 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 5.14E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 4.22E-09 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 1.22E-09 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 6.44E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 1.71E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123548345 | NA | 2.54E-08 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |