Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123526774:

Variant ID: vg0123526774 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23526774
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACGGTTGTAGAGGTCGCTGCCAGATAGCTACCTCCTTTGCAGAAGAAACATGTGGAAGGAGATATTTTGTCTGCCCCAACGTAAATAACAGCTTCGT[C/T]
GTACGTCGAAGCCTTACATTTTTTTCAATTTCGCTAACATTTGCATAATATTACTACCTTACTGACTAACTTTATTTATTTCTTAGGTCAATCCAAGGAT

Reverse complement sequence

ATCCTTGGATTGACCTAAGAAATAAATAAAGTTAGTCAGTAAGGTAGTAATATTATGCAAATGTTAGCGAAATTGAAAAAAATGTAAGGCTTCGACGTAC[G/A]
ACGAAGCTGTTATTTACGTTGGGGCAGACAAAATATCTCCTTCCACATGTTTCTTCTGCAAAGGAGGTAGCTATCTGGCAGCGACCTCTACAACCGTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.50% 0.08% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 71.50% 28.40% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 55.00% 44.90% 0.13% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123526774 C -> T LOC_Os01g41560.1 upstream_gene_variant ; 3218.0bp to feature; MODIFIER silent_mutation Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0123526774 C -> T LOC_Os01g41565.1 downstream_gene_variant ; 3315.0bp to feature; MODIFIER silent_mutation Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0123526774 C -> T LOC_Os01g41560-LOC_Os01g41565 intergenic_region ; MODIFIER silent_mutation Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123526774 NA 5.07E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 NA 1.21E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 NA 9.02E-07 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 NA 1.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 NA 4.92E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 NA 4.92E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 5.16E-08 4.39E-10 mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774 2.24E-06 1.30E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251