\
| Variant ID: vg0123526774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23526774 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )
AGTACGGTTGTAGAGGTCGCTGCCAGATAGCTACCTCCTTTGCAGAAGAAACATGTGGAAGGAGATATTTTGTCTGCCCCAACGTAAATAACAGCTTCGT[C/T]
GTACGTCGAAGCCTTACATTTTTTTCAATTTCGCTAACATTTGCATAATATTACTACCTTACTGACTAACTTTATTTATTTCTTAGGTCAATCCAAGGAT
ATCCTTGGATTGACCTAAGAAATAAATAAAGTTAGTCAGTAAGGTAGTAATATTATGCAAATGTTAGCGAAATTGAAAAAAATGTAAGGCTTCGACGTAC[G/A]
ACGAAGCTGTTATTTACGTTGGGGCAGACAAAATATCTCCTTCCACATGTTTCTTCTGCAAAGGAGGTAGCTATCTGGCAGCGACCTCTACAACCGTACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 71.50% | 28.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 55.00% | 44.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123526774 | C -> T | LOC_Os01g41560.1 | upstream_gene_variant ; 3218.0bp to feature; MODIFIER | silent_mutation | Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0123526774 | C -> T | LOC_Os01g41565.1 | downstream_gene_variant ; 3315.0bp to feature; MODIFIER | silent_mutation | Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0123526774 | C -> T | LOC_Os01g41560-LOC_Os01g41565 | intergenic_region ; MODIFIER | silent_mutation | Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123526774 | NA | 5.07E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | NA | 1.21E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | NA | 9.02E-07 | mr1428_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | NA | 1.78E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | NA | 4.92E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | NA | 4.92E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | 5.16E-08 | 4.39E-10 | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123526774 | 2.24E-06 | 1.30E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |