Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123526774:

Variant ID: vg0123526774 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23526774
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AGTACGGTTGTAGAGGTCGCTGCCAGATAGCTACCTCCTTTGCAGAAGAAACATGTGGAAGGAGATATTTTGTCTGCCCCAACGTAAATAACAGCTTCGT[C/T]
GTACGTCGAAGCCTTACATTTTTTTCAATTTCGCTAACATTTGCATAATATTACTACCTTACTGACTAACTTTATTTATTTCTTAGGTCAATCCAAGGAT

Reverse complement sequence

ATCCTTGGATTGACCTAAGAAATAAATAAAGTTAGTCAGTAAGGTAGTAATATTATGCAAATGTTAGCGAAATTGAAAAAAATGTAAGGCTTCGACGTAC[G/A]
ACGAAGCTGTTATTTACGTTGGGGCAGACAAAATATCTCCTTCCACATGTTTCTTCTGCAAAGGAGGTAGCTATCTGGCAGCGACCTCTACAACCGTACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	9.50%	0.08%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	71.50%	28.40%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	55.00%	44.90%	0.13%	0.00%	NA
Tropical Japonica	504	97.00%	3.00%	0.00%	0.00%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123526774	C -> T	LOC_Os01g41560.1	upstream_gene_variant ; 3218.0bp to feature; MODIFIER	silent_mutation	Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0123526774	C -> T	LOC_Os01g41565.1	downstream_gene_variant ; 3315.0bp to feature; MODIFIER	silent_mutation	Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0123526774	C -> T	LOC_Os01g41560-LOC_Os01g41565	intergenic_region ; MODIFIER	silent_mutation	Average:54.089; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123526774	NA	5.07E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	NA	1.21E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	NA	9.02E-07	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	NA	1.78E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	NA	4.92E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	NA	4.92E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	5.16E-08	4.39E-10	mr1977_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123526774	2.24E-06	1.30E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251