\
| Variant ID: vg0123525630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23525630 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 51. )
GATCTACTATTTGTATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCCCGCATCTCATCAACCTTTGGTCCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AAGCCGTTGTTGTTATCGACTAAGTCCGCGCCAACACAGATCCAGCACCATTGGCCAGGCGCGGGTTTTTCGATCAACACACTGATCACTACTTTCATGC
GCATGAAAGTAGTGATCAGTGTGTTGATCGAAAAACCCGCGCCTGGCCAATGGTGCTGGATCTGTGTTGGCGCGGACTTAGTCGATAACAACAACGGCTT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGACCAAAGGTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATACAAATAGTAGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 32.10% | 0.32% | 0.06% | NA |
| All Indica | 2759 | 53.10% | 46.40% | 0.47% | 0.04% | NA |
| All Japonica | 1512 | 87.10% | 12.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 11.80% | 87.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 42.80% | 56.30% | 0.65% | 0.22% | NA |
| Indica III | 913 | 84.70% | 15.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 53.80% | 45.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 23.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123525630 | C -> T | LOC_Os01g41560.1 | upstream_gene_variant ; 2074.0bp to feature; MODIFIER | silent_mutation | Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0123525630 | C -> T | LOC_Os01g41565.1 | downstream_gene_variant ; 4459.0bp to feature; MODIFIER | silent_mutation | Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0123525630 | C -> T | LOC_Os01g41560-LOC_Os01g41565 | intergenic_region ; MODIFIER | silent_mutation | Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0123525630 | C -> DEL | N | N | silent_mutation | Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123525630 | NA | 9.78E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 8.66E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 5.40E-10 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 1.73E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | 4.24E-06 | NA | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 4.19E-09 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | 2.54E-06 | NA | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 2.60E-10 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 1.06E-06 | mr1996_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123525630 | NA | 1.36E-09 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |