\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123525630:

Variant ID: vg0123525630 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23525630
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTACTATTTGTATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCCCGCATCTCATCAACCTTTGGTCCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AAGCCGTTGTTGTTATCGACTAAGTCCGCGCCAACACAGATCCAGCACCATTGGCCAGGCGCGGGTTTTTCGATCAACACACTGATCACTACTTTCATGC

Reverse complement sequence

GCATGAAAGTAGTGATCAGTGTGTTGATCGAAAAACCCGCGCCTGGCCAATGGTGCTGGATCTGTGTTGGCGCGGACTTAGTCGATAACAACAACGGCTT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGACCAAAGGTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATACAAATAGTAGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.10% 0.32% 0.06% NA
All Indica  2759 53.10% 46.40% 0.47% 0.04% NA
All Japonica  1512 87.10% 12.80% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 11.80% 87.70% 0.50% 0.00% NA
Indica II  465 42.80% 56.30% 0.65% 0.22% NA
Indica III  913 84.70% 15.10% 0.22% 0.00% NA
Indica Intermediate  786 53.80% 45.50% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 73.40% 26.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 23.70% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123525630 C -> T LOC_Os01g41560.1 upstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0123525630 C -> T LOC_Os01g41565.1 downstream_gene_variant ; 4459.0bp to feature; MODIFIER silent_mutation Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0123525630 C -> T LOC_Os01g41560-LOC_Os01g41565 intergenic_region ; MODIFIER silent_mutation Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0123525630 C -> DEL N N silent_mutation Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123525630 NA 9.78E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 8.66E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 5.40E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 1.73E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 4.24E-06 NA mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 4.19E-09 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 2.54E-06 NA mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 2.60E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 1.06E-06 mr1996_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630 NA 1.36E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251