\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123496865:

Variant ID: vg0123496865 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23496865
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TAACAGGCCTATATAGGAACCACTCTAATAGGAACAGAGTGGTGGCGGTTGATGGGACATCTAAAAACTATTAATAAATCACCAAATAAAATCCTAATGA[T/C]
GATTAAAAGGAAGGACGACGGGCATGTCGTGAAGTAATCGGTCAAGGCGGTTGGCGAGACTTCTAGAAAGTTAAAAAATAAACCCCAATGAAAATCATAT

Reverse complement sequence

ATATGATTTTCATTGGGGTTTATTTTTTAACTTTCTAGAAGTCTCGCCAACCGCCTTGACCGATTACTTCACGACATGCCCGTCGTCCTTCCTTTTAATC[A/G]
TCATTAGGATTTTATTTGGTGATTTATTAATAGTTTTTAGATGTCCCATCAACCGCCACCACTCTGTTCCTATTAGAGTGGTTCCTATATAGGCCTGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 19.00% 1.97% 10.56% NA
All Indica  2759 91.80% 5.30% 2.32% 0.51% NA
All Japonica  1512 21.20% 47.30% 1.39% 30.09% NA
Aus  269 96.70% 2.20% 0.74% 0.37% NA
Indica I  595 93.80% 2.70% 3.53% 0.00% NA
Indica II  465 90.80% 5.60% 2.80% 0.86% NA
Indica III  913 92.70% 6.20% 0.99% 0.11% NA
Indica Intermediate  786 90.10% 6.10% 2.67% 1.15% NA
Temperate Japonica  767 1.60% 71.70% 0.26% 26.47% NA
Tropical Japonica  504 43.70% 8.10% 3.37% 44.84% NA
Japonica Intermediate  241 36.90% 51.50% 0.83% 10.79% NA
VI/Aromatic  96 74.00% 6.20% 3.12% 16.67% NA
Intermediate  90 57.80% 24.40% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123496865 T -> DEL N N silent_mutation Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0123496865 T -> C LOC_Os01g41510.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0123496865 T -> C LOC_Os01g41500-LOC_Os01g41510 intergenic_region ; MODIFIER silent_mutation Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123496865 3.54E-06 3.54E-06 mr1128 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 8.00E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 1.09E-09 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 9.16E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 9.81E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 1.11E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865 NA 5.81E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251