Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123496865:

Variant ID: vg0123496865 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23496865
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TAACAGGCCTATATAGGAACCACTCTAATAGGAACAGAGTGGTGGCGGTTGATGGGACATCTAAAAACTATTAATAAATCACCAAATAAAATCCTAATGA[T/C]
GATTAAAAGGAAGGACGACGGGCATGTCGTGAAGTAATCGGTCAAGGCGGTTGGCGAGACTTCTAGAAAGTTAAAAAATAAACCCCAATGAAAATCATAT

Reverse complement sequence

ATATGATTTTCATTGGGGTTTATTTTTTAACTTTCTAGAAGTCTCGCCAACCGCCTTGACCGATTACTTCACGACATGCCCGTCGTCCTTCCTTTTAATC[A/G]
TCATTAGGATTTTATTTGGTGATTTATTAATAGTTTTTAGATGTCCCATCAACCGCCACCACTCTGTTCCTATTAGAGTGGTTCCTATATAGGCCTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	19.00%	1.97%	10.56%	NA
All Indica	2759	91.80%	5.30%	2.32%	0.51%	NA
All Japonica	1512	21.20%	47.30%	1.39%	30.09%	NA
Aus	269	96.70%	2.20%	0.74%	0.37%	NA
Indica I	595	93.80%	2.70%	3.53%	0.00%	NA
Indica II	465	90.80%	5.60%	2.80%	0.86%	NA
Indica III	913	92.70%	6.20%	0.99%	0.11%	NA
Indica Intermediate	786	90.10%	6.10%	2.67%	1.15%	NA
Temperate Japonica	767	1.60%	71.70%	0.26%	26.47%	NA
Tropical Japonica	504	43.70%	8.10%	3.37%	44.84%	NA
Japonica Intermediate	241	36.90%	51.50%	0.83%	10.79%	NA
VI/Aromatic	96	74.00%	6.20%	3.12%	16.67%	NA
Intermediate	90	57.80%	24.40%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123496865	T -> DEL	N	N	silent_mutation	Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0123496865	T -> C	LOC_Os01g41510.1	upstream_gene_variant ; 1578.0bp to feature; MODIFIER	silent_mutation	Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0123496865	T -> C	LOC_Os01g41500-LOC_Os01g41510	intergenic_region ; MODIFIER	silent_mutation	Average:31.242; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123496865	3.54E-06	3.54E-06	mr1128	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	8.00E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	1.09E-09	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	9.16E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	9.81E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	1.11E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496865	NA	5.81E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251