\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123496391:

Variant ID: vg0123496391 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23496391
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAAAAAATCTGATTCCATAAAAACCGATGCTTTTCCAAAAATTCCTCCAAAAAAAAGAGGTTGATAGGAAAAAACAAAGAGTCCAATAAAAAATC[C/T]
AATACGAGATTAGTAAAAGTTAGGAATAAAAAAATAAAAAAAATCAAAATTAGGAAAAAAAGAAAAGACAAGAAGAGTTAAGTAGAATACAATTTAAAAT

Reverse complement sequence

ATTTTAAATTGTATTCTACTTAACTCTTCTTGTCTTTTCTTTTTTTCCTAATTTTGATTTTTTTTATTTTTTTATTCCTAACTTTTACTAATCTCGTATT[G/A]
GATTTTTTATTGGACTCTTTGTTTTTTCCTATCAACCTCTTTTTTTTGGAGGAATTTTTGGAAAAGCATCGGTTTTTATGGAATCAGATTTTTTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 32.60% 0.23% 11.87% NA
All Indica  2759 52.70% 46.20% 0.11% 0.98% NA
All Japonica  1512 53.60% 13.20% 0.40% 32.87% NA
Aus  269 98.10% 1.10% 0.00% 0.74% NA
Indica I  595 12.80% 87.10% 0.17% 0.00% NA
Indica II  465 41.70% 57.00% 0.22% 1.08% NA
Indica III  913 84.20% 15.20% 0.00% 0.55% NA
Indica Intermediate  786 52.80% 44.90% 0.13% 2.16% NA
Temperate Japonica  767 71.80% 0.40% 0.52% 27.25% NA
Tropical Japonica  504 21.00% 27.20% 0.40% 51.39% NA
Japonica Intermediate  241 63.50% 24.50% 0.00% 12.03% NA
VI/Aromatic  96 30.20% 46.90% 0.00% 22.92% NA
Intermediate  90 64.40% 18.90% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123496391 C -> T LOC_Os01g41510.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:15.101; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0123496391 C -> T LOC_Os01g41500-LOC_Os01g41510 intergenic_region ; MODIFIER silent_mutation Average:15.101; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0123496391 C -> DEL N N silent_mutation Average:15.101; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123496391 NA 5.81E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.60E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 7.67E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.62E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 2.55E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 8.85E-06 NA mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.12E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 5.07E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 2.33E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 5.81E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 3.29E-06 NA mr1949 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 7.91E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 2.38E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 2.30E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.02E-06 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.91E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 4.66E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 7.58E-06 NA mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 3.28E-11 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 6.24E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 5.42E-06 NA mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.46E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 5.90E-07 NA mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 1.93E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123496391 NA 6.54E-10 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251