Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123470105:

Variant ID: vg0123470105 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23470105
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATCGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATGTCTAATTAATAGATAAACTGTCATGTCGCATCCGTCTTGAACTCG[G/A]
ACTCTTCTAGATAAGCTTCCTTTGATTGATCCGACTCCACCATGAACACGACATCGTGGCGACTTGACTCCCATCGGCTGATTCTAGAACTTTGAAGCTG

Reverse complement sequence

CAGCTTCAAAGTTCTAGAATCAGCCGATGGGAGTCAAGTCGCCACGATGTCGTGTTCATGGTGGAGTCGGATCAATCAAAGGAAGCTTATCTAGAAGAGT[C/T]
CGAGTTCAAGACGGATGCGACATGACAGTTTATCTATTAATTAGACATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCGATAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	19.40%	2.16%	9.42%	NA
All Indica	2759	65.60%	32.10%	1.41%	0.87%	NA
All Japonica	1512	67.70%	1.10%	3.84%	27.38%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	63.20%	35.50%	0.86%	0.43%	NA
Indica III	913	49.50%	46.40%	2.19%	1.86%	NA
Indica Intermediate	786	62.50%	35.00%	1.91%	0.64%	NA
Temperate Japonica	767	73.70%	0.00%	0.91%	25.42%	NA
Tropical Japonica	504	49.20%	2.40%	9.52%	38.89%	NA
Japonica Intermediate	241	87.60%	1.70%	1.24%	9.54%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	18.90%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123470105	G -> A	LOC_Os01g41460.1	upstream_gene_variant ; 2114.0bp to feature; MODIFIER	silent_mutation	Average:50.81; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0123470105	G -> A	LOC_Os01g41450.1	downstream_gene_variant ; 4920.0bp to feature; MODIFIER	silent_mutation	Average:50.81; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0123470105	G -> A	LOC_Os01g41450-LOC_Os01g41460	intergenic_region ; MODIFIER	silent_mutation	Average:50.81; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0123470105	G -> DEL	N	N	silent_mutation	Average:50.81; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123470105	NA	2.10E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	2.59E-10	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	6.73E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	1.96E-08	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	2.94E-09	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	6.29E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	1.91E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	1.40E-07	1.40E-07	mr1996	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	4.95E-06	4.95E-06	mr1996	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	1.87E-10	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	1.49E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	3.02E-12	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	2.62E-08	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	6.69E-11	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	2.03E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	5.42E-12	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	3.44E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	3.07E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	4.24E-09	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123470105	NA	1.17E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251