\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123467869:

Variant ID: vg0123467869 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23467869
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTTCGTGCAATCGGCTTTCATGAGCCGATATTGTTTGCATTAGTTGAGCTAGACTGTCAAACTCGTGGCAAAAGAATCTATCTCCGATAGGTGCTG[A/T]
CAATCCTTGGAATGCAAGATCTACTAGCTATTCATTGCTTAGGTTCAAACTATAACATCGGCTGCGGACATTACGAAATCTCTGAATATATTCCATAGCC

Reverse complement sequence

GGCTATGGAATATATTCAGAGATTTCGTAATGTCCGCAGCCGATGTTATAGTTTGAACCTAAGCAATGAATAGCTAGTAGATCTTGCATTCCAAGGATTG[T/A]
CAGCACCTATCGGAGATAGATTCTTTTGCCACGAGTTTGACAGTCTAGCTCAACTAATGCAAACAATATCGGCTCATGAAAGCCGATTGCACGAAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 5.00% 1.76% 33.05% NA
All Indica  2759 61.60% 6.90% 2.14% 29.43% NA
All Japonica  1512 66.30% 0.50% 0.40% 32.87% NA
Aus  269 9.30% 1.10% 4.83% 84.76% NA
Indica I  595 96.10% 0.30% 0.17% 3.36% NA
Indica II  465 64.30% 8.20% 1.08% 26.45% NA
Indica III  913 40.30% 12.20% 3.29% 44.25% NA
Indica Intermediate  786 58.50% 4.80% 2.93% 33.72% NA
Temperate Japonica  767 73.40% 0.10% 0.39% 26.08% NA
Tropical Japonica  504 46.40% 0.60% 0.60% 52.38% NA
Japonica Intermediate  241 85.10% 1.20% 0.00% 13.69% NA
VI/Aromatic  96 67.70% 30.20% 0.00% 2.08% NA
Intermediate  90 62.20% 6.70% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123467869 A -> T LOC_Os01g41460.1 upstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0123467869 A -> T LOC_Os01g41450.1 downstream_gene_variant ; 2684.0bp to feature; MODIFIER silent_mutation Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0123467869 A -> T LOC_Os01g41450-LOC_Os01g41460 intergenic_region ; MODIFIER silent_mutation Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0123467869 A -> DEL N N silent_mutation Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123467869 NA 8.01E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.50E-08 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.01E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 7.80E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 8.09E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.05E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 6.44E-11 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.06E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.86E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 5.10E-08 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 8.59E-10 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.02E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 6.09E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 5.79E-06 5.78E-06 mr1996 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 2.47E-11 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 3.55E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 2.20E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 4.50E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 2.75E-06 1.91E-14 mr1380_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 8.62E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.01E-06 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 1.26E-06 2.09E-16 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 1.91E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 5.87E-13 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 2.98E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 4.07E-06 1.20E-14 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 9.28E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 1.97E-06 7.34E-13 mr1996_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869 NA 5.38E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251