Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123467869:

Variant ID: vg0123467869 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23467869
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGCTTCGTGCAATCGGCTTTCATGAGCCGATATTGTTTGCATTAGTTGAGCTAGACTGTCAAACTCGTGGCAAAAGAATCTATCTCCGATAGGTGCTG[A/T]
CAATCCTTGGAATGCAAGATCTACTAGCTATTCATTGCTTAGGTTCAAACTATAACATCGGCTGCGGACATTACGAAATCTCTGAATATATTCCATAGCC

Reverse complement sequence

GGCTATGGAATATATTCAGAGATTTCGTAATGTCCGCAGCCGATGTTATAGTTTGAACCTAAGCAATGAATAGCTAGTAGATCTTGCATTCCAAGGATTG[T/A]
CAGCACCTATCGGAGATAGATTCTTTTGCCACGAGTTTGACAGTCTAGCTCAACTAATGCAAACAATATCGGCTCATGAAAGCCGATTGCACGAAGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	5.00%	1.76%	33.05%	NA
All Indica	2759	61.60%	6.90%	2.14%	29.43%	NA
All Japonica	1512	66.30%	0.50%	0.40%	32.87%	NA
Aus	269	9.30%	1.10%	4.83%	84.76%	NA
Indica I	595	96.10%	0.30%	0.17%	3.36%	NA
Indica II	465	64.30%	8.20%	1.08%	26.45%	NA
Indica III	913	40.30%	12.20%	3.29%	44.25%	NA
Indica Intermediate	786	58.50%	4.80%	2.93%	33.72%	NA
Temperate Japonica	767	73.40%	0.10%	0.39%	26.08%	NA
Tropical Japonica	504	46.40%	0.60%	0.60%	52.38%	NA
Japonica Intermediate	241	85.10%	1.20%	0.00%	13.69%	NA
VI/Aromatic	96	67.70%	30.20%	0.00%	2.08%	NA
Intermediate	90	62.20%	6.70%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123467869	A -> T	LOC_Os01g41460.1	upstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0123467869	A -> T	LOC_Os01g41450.1	downstream_gene_variant ; 2684.0bp to feature; MODIFIER	silent_mutation	Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0123467869	A -> T	LOC_Os01g41450-LOC_Os01g41460	intergenic_region ; MODIFIER	silent_mutation	Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0123467869	A -> DEL	N	N	silent_mutation	Average:17.973; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123467869	NA	8.01E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.50E-08	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.01E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	7.80E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	8.09E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.05E-07	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	6.44E-11	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.06E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.86E-09	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	5.10E-08	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	8.59E-10	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.02E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	6.09E-08	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	5.79E-06	5.78E-06	mr1996	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	2.47E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	3.55E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	2.20E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	4.50E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	2.75E-06	1.91E-14	mr1380_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	8.62E-10	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.01E-06	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	1.26E-06	2.09E-16	mr1561_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	1.91E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	5.87E-13	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	2.98E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	4.07E-06	1.20E-14	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	9.28E-09	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	1.97E-06	7.34E-13	mr1996_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123467869	NA	5.38E-09	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251