\
| Variant ID: vg0123436071 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 23436071 |
| Reference Allele: TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC | Alternative Allele: CGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC,T |
| Primary Allele: CGGTTGAAATAACCGGAACT AAAGATACATCTTTAGTCCC | Secondary Allele: TGGTTGAAATAACCGGAACT AAAGATACATCTTTAGTCCC |
Inferred Ancestral Allele: Not determined.
GGTGGAGAAAGGATTTGTAGTCCCGATTGGTAACCCTCTGTAGTCCCGGTTTTTCAACCGGGACTACGAATCTGGGACTAAAGATGTCCATCTTTAGTCC[TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC/CGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC,T]
GGTTCGTAACACCAACCAGGACTAAAGATTTAGTCCCGGTTGATGTAACCAACCGGGACTAAAGTTTTTTTTTTTCTTTTTTTTCTTTTCTCATGTTCAA
TTGAACATGAGAAAAGAAAAAAAAGAAAAAAAAAAACTTTAGTCCCGGTTGGTTACATCAACCGGGACTAAATCTTTAGTCCTGGTTGGTGTTACGAACC[GGGACTAAAGATGTATCTTTAGTTCCGGTTATTTCAACCA/GGGACTAAAGATGTATCTTTAGTTCCGGTTATTTCAACCG,A]
GGACTAAAGATGGACATCTTTAGTCCCAGATTCGTAGTCCCGGTTGAAAAACCGGGACTACAGAGGGTTACCAATCGGGACTACAAATCCTTTCTCCACC
| Populations | Population Size | Frequency of CGGTTGAAATAACCGGAACT AAAGATACATCTTTAGTCCC(primary allele) | Frequency of TGGTTGAAATAACCGGAACT AAAGATACATCTTTAGTCCC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 27.20% | 3.05% | 14.07% | T: 2.26% |
| All Indica | 2759 | 79.90% | 11.30% | 3.04% | 1.96% | T: 3.77% |
| All Japonica | 1512 | 14.40% | 44.80% | 3.44% | 37.30% | NA |
| Aus | 269 | 5.60% | 93.30% | 0.37% | 0.37% | T: 0.37% |
| Indica I | 595 | 92.30% | 0.30% | 2.35% | 0.67% | T: 4.37% |
| Indica II | 465 | 94.00% | 3.20% | 0.65% | 1.51% | T: 0.65% |
| Indica III | 913 | 64.00% | 23.90% | 4.49% | 2.63% | T: 5.04% |
| Indica Intermediate | 786 | 80.80% | 9.80% | 3.31% | 2.42% | T: 3.69% |
| Temperate Japonica | 767 | 0.40% | 63.60% | 0.52% | 35.46% | NA |
| Tropical Japonica | 504 | 30.40% | 10.50% | 7.54% | 51.59% | NA |
| Japonica Intermediate | 241 | 25.70% | 56.80% | 4.15% | 13.28% | NA |
| VI/Aromatic | 96 | 49.00% | 16.70% | 3.12% | 31.25% | NA |
| Intermediate | 90 | 42.20% | 33.30% | 4.44% | 17.78% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123436071 | TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC -> CGGTTGAAATAACCGGAACTAAAGATACAT CTTTAGTCCC | LOC_Os01g41400.1 | upstream_gene_variant ; 3438.0bp to feature; MODIFIER | silent_mutation | Average:43.133; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0123436071 | TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC -> CGGTTGAAATAACCGGAACTAAAGATACAT CTTTAGTCCC | LOC_Os01g41390-LOC_Os01g41400 | intergenic_region ; MODIFIER | silent_mutation | Average:43.133; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0123436071 | TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC -> T | LOC_Os01g41400.1 | upstream_gene_variant ; 3437.0bp to feature; MODIFIER | silent_mutation | Average:43.133; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0123436071 | TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC -> T | LOC_Os01g41390-LOC_Os01g41400 | intergenic_region ; MODIFIER | silent_mutation | Average:43.133; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0123436071 | TGGTTGAAATAACCGGAACTAAAGATACATCTTTAGTCCC -> DEL | N | N | silent_mutation | Average:43.133; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123436071 | NA | 2.53E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 4.89E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.87E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 4.70E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 7.42E-06 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 8.57E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 2.81E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 2.47E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 5.86E-06 | 4.09E-07 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.39E-06 | mr1440 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 3.97E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 3.38E-06 | 3.37E-06 | mr1452 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 8.42E-07 | 1.82E-07 | mr1513 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 5.04E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 3.73E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 9.26E-07 | 8.12E-06 | mr1590 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 6.01E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 9.73E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 3.59E-06 | NA | mr1630 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 2.84E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | 8.04E-06 | 8.03E-06 | mr1694 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.12E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 6.63E-06 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 2.32E-10 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.07E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.06E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 1.94E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 9.89E-07 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123436071 | NA | 4.42E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |