\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123426408:

Variant ID: vg0123426408 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23426408
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAGCCAGCGCGGAGGGGAGGCGGCAGTGGCCGCCGGCTGGATTTTTTTTTTTTTTGAGATATGAATCTGTGATGTATTTTTGTGTGAGATGTGAATTT[G/C]
TGATGTATTTTTTTGTGAGATGTGAATCTGTGATGAATTTTTTAGAACCCTGTGATGTAATTTTTTTAAGAGTTTGTGATGTATTTGGAGATGATCTATT

Reverse complement sequence

AATAGATCATCTCCAAATACATCACAAACTCTTAAAAAAATTACATCACAGGGTTCTAAAAAATTCATCACAGATTCACATCTCACAAAAAAATACATCA[C/G]
AAATTCACATCTCACACAAAAATACATCACAGATTCATATCTCAAAAAAAAAAAAAATCCAGCCGGCGGCCACTGCCGCCTCCCCTCCGCGCTGGCTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 39.30% 0.28% 13.18% NA
All Indica  2759 40.30% 58.80% 0.18% 0.72% NA
All Japonica  1512 54.20% 8.50% 0.46% 36.84% NA
Aus  269 92.90% 6.70% 0.00% 0.37% NA
Indica I  595 3.90% 96.10% 0.00% 0.00% NA
Indica II  465 38.70% 60.20% 0.00% 1.08% NA
Indica III  913 62.50% 37.00% 0.11% 0.33% NA
Indica Intermediate  786 43.00% 55.00% 0.51% 1.53% NA
Temperate Japonica  767 63.50% 1.00% 0.78% 34.68% NA
Tropical Japonica  504 32.50% 15.90% 0.20% 51.39% NA
Japonica Intermediate  241 69.70% 17.00% 0.00% 13.28% NA
VI/Aromatic  96 3.10% 65.60% 1.04% 30.21% NA
Intermediate  90 53.30% 28.90% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123426408 G -> DEL N N silent_mutation Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0123426408 G -> C LOC_Os01g41390.1 downstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0123426408 G -> C LOC_Os01g41390-LOC_Os01g41400 intergenic_region ; MODIFIER silent_mutation Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123426408 NA 2.85E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 3.15E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 4.52E-07 1.63E-07 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 6.65E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 4.21E-06 2.02E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 2.77E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 9.29E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 5.23E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 3.31E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 5.72E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 3.06E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 2.81E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 7.09E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408 NA 8.10E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251