Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123426408:

Variant ID: vg0123426408 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23426408
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCAGCCAGCGCGGAGGGGAGGCGGCAGTGGCCGCCGGCTGGATTTTTTTTTTTTTTGAGATATGAATCTGTGATGTATTTTTGTGTGAGATGTGAATTT[G/C]
TGATGTATTTTTTTGTGAGATGTGAATCTGTGATGAATTTTTTAGAACCCTGTGATGTAATTTTTTTAAGAGTTTGTGATGTATTTGGAGATGATCTATT

Reverse complement sequence

AATAGATCATCTCCAAATACATCACAAACTCTTAAAAAAATTACATCACAGGGTTCTAAAAAATTCATCACAGATTCACATCTCACAAAAAAATACATCA[C/G]
AAATTCACATCTCACACAAAAATACATCACAGATTCATATCTCAAAAAAAAAAAAAATCCAGCCGGCGGCCACTGCCGCCTCCCCTCCGCGCTGGCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	39.30%	0.28%	13.18%	NA
All Indica	2759	40.30%	58.80%	0.18%	0.72%	NA
All Japonica	1512	54.20%	8.50%	0.46%	36.84%	NA
Aus	269	92.90%	6.70%	0.00%	0.37%	NA
Indica I	595	3.90%	96.10%	0.00%	0.00%	NA
Indica II	465	38.70%	60.20%	0.00%	1.08%	NA
Indica III	913	62.50%	37.00%	0.11%	0.33%	NA
Indica Intermediate	786	43.00%	55.00%	0.51%	1.53%	NA
Temperate Japonica	767	63.50%	1.00%	0.78%	34.68%	NA
Tropical Japonica	504	32.50%	15.90%	0.20%	51.39%	NA
Japonica Intermediate	241	69.70%	17.00%	0.00%	13.28%	NA
VI/Aromatic	96	3.10%	65.60%	1.04%	30.21%	NA
Intermediate	90	53.30%	28.90%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123426408	G -> DEL	N	N	silent_mutation	Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0123426408	G -> C	LOC_Os01g41390.1	downstream_gene_variant ; 2039.0bp to feature; MODIFIER	silent_mutation	Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0123426408	G -> C	LOC_Os01g41390-LOC_Os01g41400	intergenic_region ; MODIFIER	silent_mutation	Average:37.839; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123426408	NA	2.85E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	3.15E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	4.52E-07	1.63E-07	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	6.65E-06	NA	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	4.21E-06	2.02E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	2.77E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	9.29E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	5.23E-07	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	3.31E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	5.72E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	3.06E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	2.81E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	7.09E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123426408	NA	8.10E-09	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251