\
| Variant ID: vg0123425063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23425063 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )
TCTTTTAGTTTTCTACTTTGACTGATTAATTTGTGGTATTAAACTTAGTTATTAACTTGTACCAATATTATAGTGAATTGCTTATGCTAAACATAGTTTA[C/T]
ATAATTTTTTCCATAAATTTTTCCATGATTTCATCTTGCATAGATTATTTTAAAGAATTAGAATAACATTTCTTTGTATATGTGTCCCTACTTCATAATT
AATTATGAAGTAGGGACACATATACAAAGAAATGTTATTCTAATTCTTTAAAATAATCTATGCAAGATGAAATCATGGAAAAATTTATGGAAAAAATTAT[G/A]
TAAACTATGTTTAGCATAAGCAATTCACTATAATATTGGTACAAGTTAATAACTAAGTTTAATACCACAAATTAATCAGTCAAAGTAGAAAACTAAAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 0.60% | 8.65% | 0.13% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 71.20% | 1.90% | 26.59% | 0.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 74.60% | 2.50% | 22.69% | 0.26% | NA |
| Tropical Japonica | 504 | 57.30% | 0.20% | 41.67% | 0.79% | NA |
| Japonica Intermediate | 241 | 89.20% | 3.30% | 7.47% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123425063 | C -> T | LOC_Os01g41390.1 | downstream_gene_variant ; 694.0bp to feature; MODIFIER | silent_mutation | Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0123425063 | C -> T | LOC_Os01g41390-LOC_Os01g41400 | intergenic_region ; MODIFIER | silent_mutation | Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0123425063 | C -> DEL | N | N | silent_mutation | Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123425063 | 6.59E-07 | 5.02E-06 | mr1114 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 8.59E-06 | NA | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 2.41E-06 | 8.69E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 1.85E-06 | 1.48E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 8.54E-06 | 2.51E-07 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 7.64E-08 | 1.17E-07 | mr1917 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123425063 | 2.15E-06 | 1.98E-07 | mr1936 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |