\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123425063:

Variant ID: vg0123425063 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23425063
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTAGTTTTCTACTTTGACTGATTAATTTGTGGTATTAAACTTAGTTATTAACTTGTACCAATATTATAGTGAATTGCTTATGCTAAACATAGTTTA[C/T]
ATAATTTTTTCCATAAATTTTTCCATGATTTCATCTTGCATAGATTATTTTAAAGAATTAGAATAACATTTCTTTGTATATGTGTCCCTACTTCATAATT

Reverse complement sequence

AATTATGAAGTAGGGACACATATACAAAGAAATGTTATTCTAATTCTTTAAAATAATCTATGCAAGATGAAATCATGGAAAAATTTATGGAAAAAATTAT[G/A]
TAAACTATGTTTAGCATAAGCAATTCACTATAATATTGGTACAAGTTAATAACTAAGTTTAATACCACAAATTAATCAGTCAAAGTAGAAAACTAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 0.60% 8.65% 0.13% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 71.20% 1.90% 26.59% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 74.60% 2.50% 22.69% 0.26% NA
Tropical Japonica  504 57.30% 0.20% 41.67% 0.79% NA
Japonica Intermediate  241 89.20% 3.30% 7.47% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 95.60% 0.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123425063 C -> T LOC_Os01g41390.1 downstream_gene_variant ; 694.0bp to feature; MODIFIER silent_mutation Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0123425063 C -> T LOC_Os01g41390-LOC_Os01g41400 intergenic_region ; MODIFIER silent_mutation Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0123425063 C -> DEL N N silent_mutation Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123425063 6.59E-07 5.02E-06 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 8.59E-06 NA mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 2.41E-06 8.69E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 1.85E-06 1.48E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 8.54E-06 2.51E-07 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 7.64E-08 1.17E-07 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063 2.15E-06 1.98E-07 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251