Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123407656:

Variant ID: vg0123407656 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23407656
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAATTAGCTGATCGATTGATCGAACTATTGGTAACCGCTATTGTCAGTACGACAAAAAGATGATAATGGCAAGCTAGGGCAAGGCGAGATTAGGGGAGC[G/A]
AAATTTGAACGCCTACGTGGGAGAAAATATCTCATAATTGAGAGTGATCGGAAGCGGATTGGCTTAAAGTAAATGTTGATGGCTCTTATTGCGCATTCTC

Reverse complement sequence

GAGAATGCGCAATAAGAGCCATCAACATTTACTTTAAGCCAATCCGCTTCCGATCACTCTCAATTATGAGATATTTTCTCCCACGTAGGCGTTCAAATTT[C/T]
GCTCCCCTAATCTCGCCTTGCCCTAGCTTGCCATTATCATCTTTTTGTCGTACTGACAATAGCGGTTACCAATAGTTCGATCAATCGATCAGCTAATTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.20%	0.15%	0.00%	NA
All Indica	2759	93.60%	6.20%	0.22%	0.00%	NA
All Japonica	1512	56.20%	43.70%	0.07%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	91.80%	7.90%	0.34%	0.00%	NA
Indica II	465	94.80%	4.90%	0.22%	0.00%	NA
Indica III	913	94.20%	5.70%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	6.10%	0.25%	0.00%	NA
Temperate Japonica	767	34.60%	65.30%	0.13%	0.00%	NA
Tropical Japonica	504	92.70%	7.30%	0.00%	0.00%	NA
Japonica Intermediate	241	49.00%	51.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123407656	G -> A	LOC_Os01g41370.1	upstream_gene_variant ; 967.0bp to feature; MODIFIER	silent_mutation	Average:45.428; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0123407656	G -> A	LOC_Os01g41360.1	downstream_gene_variant ; 3534.0bp to feature; MODIFIER	silent_mutation	Average:45.428; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0123407656	G -> A	LOC_Os01g41360-LOC_Os01g41370	intergenic_region ; MODIFIER	silent_mutation	Average:45.428; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123407656	3.86E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	5.54E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	2.37E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	1.77E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	2.56E-13	mr1441	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	2.60E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	1.53E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	9.79E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	8.34E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123407656	NA	9.54E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251