\
| Variant ID: vg0123406476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23406476 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCTTTGACACCTCCGAAGATCATCTCCCTATACAGAGTTTTGGTAGTAAATTCTCCTGTTTTTGTCAATTTCCATATCATTGTGTCTTTGTTAGAAGT[T/C]
AGCTGTATGTCTCTTAGTTTCTCATGCAAATCATTCCACTCCCCTACTTCTCTGTTTCCAATTGTTCTTCTTATACCAATCTCCCATTCCCCCCAGTGTT
AACACTGGGGGGAATGGGAGATTGGTATAAGAAGAACAATTGGAAACAGAGAAGTAGGGGAGTGGAATGATTTGCATGAGAAACTAAGAGACATACAGCT[A/G]
ACTTCTAACAAAGACACAATGATATGGAAATTGACAAAAACAGGAGAATTTACTACCAAAACTCTGTATAGGGAGATGATCTTCGGAGGTGTCAAAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123406476 | T -> C | LOC_Os01g41370.1 | upstream_gene_variant ; 2147.0bp to feature; MODIFIER | silent_mutation | Average:41.817; most accessible tissue: Callus, score: 69.373 | N | N | N | N |
| vg0123406476 | T -> C | LOC_Os01g41360.1 | downstream_gene_variant ; 2354.0bp to feature; MODIFIER | silent_mutation | Average:41.817; most accessible tissue: Callus, score: 69.373 | N | N | N | N |
| vg0123406476 | T -> C | LOC_Os01g41360-LOC_Os01g41370 | intergenic_region ; MODIFIER | silent_mutation | Average:41.817; most accessible tissue: Callus, score: 69.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123406476 | 9.37E-07 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 1.39E-06 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | 4.35E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 7.26E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 9.13E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | 5.11E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 1.72E-06 | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 1.88E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 7.00E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 8.58E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | 1.00E-06 | NA | mr1467 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | 1.73E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123406476 | NA | 2.97E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |