\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123406453:

Variant ID: vg0123406453 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23406453
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCAAATATCCTGTGGGATCTAGTATCTTTGACACCTCCGAAGATCATCTCCCTATACAGAGTTTTGGTAGTAAATTCTCCTGTTTTTGTCAATTTCCAT[A/C]
TCATTGTGTCTTTGTTAGAAGTTAGCTGTATGTCTCTTAGTTTCTCATGCAAATCATTCCACTCCCCTACTTCTCTGTTTCCAATTGTTCTTCTTATACC

Reverse complement sequence

GGTATAAGAAGAACAATTGGAAACAGAGAAGTAGGGGAGTGGAATGATTTGCATGAGAAACTAAGAGACATACAGCTAACTTCTAACAAAGACACAATGA[T/G]
ATGGAAATTGACAAAAACAGGAGAATTTACTACCAAAACTCTGTATAGGGAGATGATCTTCGGAGGTGTCAAAGATACTAGATCCCACAGGATATTTGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.90% 0.00% 0.00% NA
All Indica  2759 85.00% 15.00% 0.00% 0.00% NA
All Japonica  1512 52.40% 47.60% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 91.80% 8.20% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 71.90% 28.10% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.50% 0.00% 0.00% NA
Temperate Japonica  767 37.20% 62.80% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 39.80% 60.20% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123406453 A -> C LOC_Os01g41370.1 upstream_gene_variant ; 2170.0bp to feature; MODIFIER silent_mutation Average:41.922; most accessible tissue: Callus, score: 69.373 N N N N
vg0123406453 A -> C LOC_Os01g41360.1 downstream_gene_variant ; 2331.0bp to feature; MODIFIER silent_mutation Average:41.922; most accessible tissue: Callus, score: 69.373 N N N N
vg0123406453 A -> C LOC_Os01g41360-LOC_Os01g41370 intergenic_region ; MODIFIER silent_mutation Average:41.922; most accessible tissue: Callus, score: 69.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123406453 7.14E-07 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 1.39E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 3.33E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 7.38E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 9.13E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 4.47E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 3.34E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 1.88E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 8.58E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 2.43E-06 NA mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 1.84E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123406453 NA 7.21E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251