\
| Variant ID: vg0123384350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23384350 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 313. )
GCAACATTGAGATATTTTGCCATTTATCAATTCCTTGAAACAAATCTTTAGCATACATAAATGAAGATACAATTATAGATGTGAGTCAAGATAGAAGATT[C/T]
ATGCTGACCTCACCGCAGCTAGCCCATATCAAACCCAATTCAACATTTCTCCCTTCAATAGCACGTAGAGGATATAGGGCCCTAAGGATCATGTCACAAA
TTTGTGACATGATCCTTAGGGCCCTATATCCTCTACGTGCTATTGAAGGGAGAAATGTTGAATTGGGTTTGATATGGGCTAGCTGCGGTGAGGTCAGCAT[G/A]
AATCTTCTATCTTGACTCACATCTATAATTGTATCTTCATTTATGTATGCTAAAGATTTGTTTCAAGGAATTGATAAATGGCAAAATATCTCAATGTTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.10% | 40.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.70% | 62.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123384350 | C -> T | LOC_Os01g41330.1 | downstream_gene_variant ; 3526.0bp to feature; MODIFIER | silent_mutation | Average:42.796; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| vg0123384350 | C -> T | LOC_Os01g41320.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.796; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123384350 | NA | 8.18E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 2.43E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 2.37E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 3.36E-08 | mr1149 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 6.80E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 3.80E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 1.74E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 2.87E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 1.57E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123384350 | NA | 4.48E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |