Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123384350:

Variant ID: vg0123384350 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23384350
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACATTGAGATATTTTGCCATTTATCAATTCCTTGAAACAAATCTTTAGCATACATAAATGAAGATACAATTATAGATGTGAGTCAAGATAGAAGATT[C/T]
ATGCTGACCTCACCGCAGCTAGCCCATATCAAACCCAATTCAACATTTCTCCCTTCAATAGCACGTAGAGGATATAGGGCCCTAAGGATCATGTCACAAA

Reverse complement sequence

TTTGTGACATGATCCTTAGGGCCCTATATCCTCTACGTGCTATTGAAGGGAGAAATGTTGAATTGGGTTTGATATGGGCTAGCTGCGGTGAGGTCAGCAT[G/A]
AATCTTCTATCTTGACTCACATCTATAATTGTATCTTCATTTATGTATGCTAAAGATTTGTTTCAAGGAATTGATAAATGGCAAAATATCTCAATGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	13.40%	0.02%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	59.10%	40.90%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	37.70%	62.20%	0.13%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	50.20%	49.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123384350	C -> T	LOC_Os01g41330.1	downstream_gene_variant ; 3526.0bp to feature; MODIFIER	silent_mutation	Average:42.796; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N
vg0123384350	C -> T	LOC_Os01g41320.1	intron_variant ; MODIFIER	silent_mutation	Average:42.796; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123384350	NA	8.18E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	2.43E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	2.37E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	3.36E-08	mr1149	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	6.80E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	3.80E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	1.74E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	2.87E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	1.57E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123384350	NA	4.48E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251