Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123367773:

Variant ID: vg0123367773 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23367773
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGTGAGCTTGTCCTCCGGCATCCATGGAGCAGCGGCGGGCATCCAAGGGGACGGTGGCACCGAGCATGCCTCTCTCCGAGTTTTCATCTTCTTCAC[C/T]
GGCGGAAGGAGCGGCCACCGCCCGTTGTTTCCGTTCTCAATCTAGAAACCACCGAGAGCCACCTTTTTTTCCATTTGACGGATCCAGAAGGAGAAGAAAG

Reverse complement sequence

CTTTCTTCTCCTTCTGGATCCGTCAAATGGAAAAAAAGGTGGCTCTCGGTGGTTTCTAGATTGAGAACGGAAACAACGGGCGGTGGCCGCTCCTTCCGCC[G/A]
GTGAAGAAGATGAAAACTCGGAGAGAGGCATGCTCGGTGCCACCGTCCCCTTGGATGCCCGCCGCTGCTCCATGGATGCCGGAGGACAAGCTCACCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 3.80% 0.34% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 87.90% 11.00% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 67.70% 29.60% 2.78% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123367773 C -> T LOC_Os01g41290.1 downstream_gene_variant ; 1775.0bp to feature; MODIFIER silent_mutation Average:53.414; most accessible tissue: Zhenshan97 flower, score: 71.071 N N N N
vg0123367773 C -> T LOC_Os01g41300.1 intron_variant ; MODIFIER silent_mutation Average:53.414; most accessible tissue: Zhenshan97 flower, score: 71.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123367773 1.30E-06 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 8.24E-07 NA mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 7.28E-06 4.81E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 9.89E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 4.45E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 6.38E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 1.35E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 8.84E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 1.80E-06 3.87E-12 mr1241 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 1.08E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 3.14E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 6.05E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 4.61E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 1.08E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 1.45E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 5.19E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123367773 NA 7.09E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251