\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123349791:

Variant ID: vg0123349791 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23349791
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, A: 0.34, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTTACTGCTGCAAGCAGCAAGAAAATGATGTACCTACATCCATGATCTTGCATTTAAGAATTAGATGGCTAGACCACTTTTGACTGTCATCAGAAT[A/T]
TACAATATTGAATGTCCAACCAAAGTTTTGTTCTAATAATATTATTCAGCAACGTAAGCAATCCACGTGAACAACATACCAGAAATCCAACTGTGTTGAT

Reverse complement sequence

ATCAACACAGTTGGATTTCTGGTATGTTGTTCACGTGGATTGCTTACGTTGCTGAATAATATTATTAGAACAAAACTTTGGTTGGACATTCAATATTGTA[T/A]
ATTCTGATGACAGTCAAAAGTGGTCTAGCCATCTAATTCTTAAATGCAAGATCATGGATGTAGGTACATCATTTTCTTGCTGCTTGCAGCAGTAACAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 27.80% 0.08% 0.32% NA
All Indica  2759 75.10% 24.20% 0.14% 0.51% NA
All Japonica  1512 59.50% 40.50% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 64.30% 34.80% 0.00% 0.86% NA
Indica III  913 68.60% 30.90% 0.11% 0.44% NA
Indica Intermediate  786 71.80% 27.10% 0.38% 0.76% NA
Temperate Japonica  767 38.20% 61.80% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123349791 A -> T LOC_Os01g41260.1 upstream_gene_variant ; 2055.0bp to feature; MODIFIER silent_mutation Average:59.826; most accessible tissue: Callus, score: 86.307 N N N N
vg0123349791 A -> T LOC_Os01g41240.1 downstream_gene_variant ; 4330.0bp to feature; MODIFIER silent_mutation Average:59.826; most accessible tissue: Callus, score: 86.307 N N N N
vg0123349791 A -> T LOC_Os01g41250.1 downstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:59.826; most accessible tissue: Callus, score: 86.307 N N N N
vg0123349791 A -> T LOC_Os01g41250-LOC_Os01g41260 intergenic_region ; MODIFIER silent_mutation Average:59.826; most accessible tissue: Callus, score: 86.307 N N N N
vg0123349791 A -> DEL N N silent_mutation Average:59.826; most accessible tissue: Callus, score: 86.307 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123349791 NA 3.22E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 4.22E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 3.06E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 2.10E-06 1.84E-14 mr1149 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 3.66E-08 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 5.14E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 8.30E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 3.17E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 2.08E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 2.58E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 7.07E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 8.19E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 1.18E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 5.42E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123349791 NA 4.34E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251