Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123307230:

Variant ID: vg0123307230 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23307230
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GATACAATAAGTTAAGAAGTTATGCAACAACTTATTTATTTGGAGCACTTTTTTATACATATTTATTTTTTAAGTACTTATTTTGACAATATACTAACGT[G/T]
GATTTGTATATAAGCATATTTATATTTTTATTATAATAACTAATAACTAAAAGTCAATTAAACTGGATGTAAAAATTATTATATTTCGGTTGAGATTTGG

Reverse complement sequence

CCAAATCTCAACCGAAATATAATAATTTTTACATCCAGTTTAATTGACTTTTAGTTATTAGTTATTATAATAAAAATATAAATATGCTTATATACAAATC[C/A]
ACGTTAGTATATTGTCAAAATAAGTACTTAAAAAATAAATATGTATAAAAAAGTGCTCCAAATAAATAAGTTGTTGCATAACTTCTTAACTTATTGTATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	26.70%	0.28%	0.00%	NA
All Indica	2759	54.60%	45.00%	0.40%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	11.60%	88.10%	0.34%	0.00%	NA
Indica II	465	42.40%	57.40%	0.22%	0.00%	NA
Indica III	913	87.60%	12.00%	0.33%	0.00%	NA
Indica Intermediate	786	56.00%	43.40%	0.64%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123307230	G -> T	LOC_Os01g41160.1	upstream_gene_variant ; 4272.0bp to feature; MODIFIER	silent_mutation	Average:25.805; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0123307230	G -> T	LOC_Os01g41170.1	downstream_gene_variant ; 3941.0bp to feature; MODIFIER	silent_mutation	Average:25.805; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0123307230	G -> T	LOC_Os01g41160-LOC_Os01g41170	intergenic_region ; MODIFIER	silent_mutation	Average:25.805; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123307230	NA	1.66E-43	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.52E-09	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	4.16E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.20E-07	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.01E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.34E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.15E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.54E-29	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.57E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.11E-21	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	3.86E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	3.18E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	3.32E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.80E-07	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	3.19E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	4.83E-08	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.52E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.94E-07	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.62E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.59E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.44E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	4.17E-11	mr1380_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	1.79E-11	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.14E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	2.47E-09	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	3.12E-10	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.98E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123307230	NA	5.45E-10	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251