\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123217347:

Variant ID: vg0123217347 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23217347
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TATAATATCCGACAACTTATATAATATCCGATGTGACAACCTATATAATTAACTGACGGATTCTGTAATTAGTTTTTTTATTAGTGCCTAAACACCTCAT[G/A]
CGATAACCTATATAATATCCGATGTGACACGTCAAAATTTTACACAATGAATCTAAACATCCCCTCAGTCATCTTGCAAATTCCTTTCTGGGTGGAGCGA

Reverse complement sequence

TCGCTCCACCCAGAAAGGAATTTGCAAGATGACTGAGGGGATGTTTAGATTCATTGTGTAAAATTTTGACGTGTCACATCGGATATTATATAGGTTATCG[C/T]
ATGAGGTGTTTAGGCACTAATAAAAAAACTAATTACAGAATCCGTCAGTTAATTATATAGGTTGTCACATCGGATATTATATAAGTTGTCGGATATTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 40.80% 0.23% 0.00% NA
All Indica  2759 84.30% 15.50% 0.18% 0.00% NA
All Japonica  1512 4.50% 95.20% 0.26% 0.00% NA
Aus  269 97.00% 2.20% 0.74% 0.00% NA
Indica I  595 79.20% 20.70% 0.17% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 84.60% 15.30% 0.11% 0.00% NA
Indica Intermediate  786 81.60% 18.10% 0.38% 0.00% NA
Temperate Japonica  767 3.50% 96.10% 0.39% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 14.90% 84.60% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123217347 G -> A LOC_Os01g41000.1 upstream_gene_variant ; 2050.0bp to feature; MODIFIER silent_mutation Average:87.462; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0123217347 G -> A LOC_Os01g40990.2 downstream_gene_variant ; 3626.0bp to feature; MODIFIER silent_mutation Average:87.462; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0123217347 G -> A LOC_Os01g40990.3 downstream_gene_variant ; 3655.0bp to feature; MODIFIER silent_mutation Average:87.462; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0123217347 G -> A LOC_Os01g41000-LOC_Os01g41010 intergenic_region ; MODIFIER silent_mutation Average:87.462; most accessible tissue: Minghui63 flower, score: 94.203 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123217347 G A -0.01 0.01 0.0 0.02 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123217347 NA 2.48E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 3.83E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 2.75E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 1.18E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 1.37E-07 1.37E-07 mr1915 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 4.49E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 7.77E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 7.27E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 7.86E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 3.96E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 7.12E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 3.06E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 2.42E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 4.87E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 2.50E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 3.06E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 1.00E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123217347 NA 5.31E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251