Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123100456:

Variant ID: vg0123100456 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23100456
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, T: 0.39, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCCTTCCCTGCCTGCTACCGGCTTCGCCGCCGGCGGGCTCCAGCGGCGGCGAGGTAGGGGGAGGGAGGGAGAGAAGGCGCGGGTGGCTAGGGTTTTT[G/T]
CGCCCCCGAGCCGCCCGACACGAAAGCTATGCGCGGGGGAGGGGGGGCTGAACTGAAGTTAGGAAATTAACAACAGAGGGTGTGTTTAGTTCACGCTAAA

Reverse complement sequence

TTTAGCGTGAACTAAACACACCCTCTGTTGTTAATTTCCTAACTTCAGTTCAGCCCCCCCTCCCCCGCGCATAGCTTTCGTGTCGGGCGGCTCGGGGGCG[C/A]
AAAAACCCTAGCCACCCGCGCCTTCTCTCCCTCCCTCCCCCTACCTCGCCGCCGCTGGAGCCCGCCGGCGGCGAAGCCGGTAGCAGGCAGGGAAGGCGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 23.50% 0.08% 5.73% NA
All Indica  2759 91.10% 6.80% 0.04% 2.10% NA
All Japonica  1512 27.60% 58.40% 0.20% 13.76% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 82.00% 16.10% 0.00% 1.85% NA
Indica II  465 97.00% 2.40% 0.00% 0.65% NA
Indica III  913 96.60% 1.90% 0.00% 1.53% NA
Indica Intermediate  786 88.00% 8.00% 0.13% 3.82% NA
Temperate Japonica  767 3.10% 86.20% 0.13% 10.56% NA
Tropical Japonica  504 57.90% 24.20% 0.20% 17.66% NA
Japonica Intermediate  241 42.30% 41.50% 0.41% 15.77% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 26.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123100456 G -> T LOC_Os01g40860.1 intron_variant ; MODIFIER silent_mutation Average:80.016; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N
vg0123100456 G -> DEL N N silent_mutation Average:80.016; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123100456 G T 0.0 -0.03 -0.06 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123100456 1.17E-07 1.19E-24 mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123100456 NA 9.39E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123100456 NA 1.65E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251