\
| Variant ID: vg0122966094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22966094 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 213. )
AGTGAATGGTAGAAAGTTGTGATTGGTTGAAAAGAGAATATTGGTGGAAAAGTTATTATATTTTGGGATAAATCCTGGAGGCTAAAAGTTGTTATATTTT[G/A]
GGATGGAGAGAGTAGTGTTTTTAAGGCATTCCCGGTACTTGAACTCATTAAGTCAAGAAAAATGTTGAACCCACGCTAATTGTTGCAGTAGACAATTTCT
AGAAATTGTCTACTGCAACAATTAGCGTGGGTTCAACATTTTTCTTGACTTAATGAGTTCAAGTACCGGGAATGCCTTAAAAACACTACTCTCTCCATCC[C/T]
AAAATATAACAACTTTTAGCCTCCAGGATTTATCCCAAAATATAATAACTTTTCCACCAATATTCTCTTTTCAACCAATCACAACTTTCTACCATTCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.60% | 30.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122966094 | G -> A | LOC_Os01g40630-LOC_Os01g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:48.918; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122966094 | NA | 7.43E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | 2.88E-06 | 2.88E-06 | mr1374_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | 1.62E-06 | 1.62E-06 | mr1634_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 3.84E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 8.29E-06 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 2.04E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 3.91E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 6.01E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 4.75E-06 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 1.82E-06 | mr1811_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 7.37E-06 | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 4.22E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122966094 | NA | 6.56E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |