Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122960572:

Variant ID: vg0122960572 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22960572
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATAAGGTTAAAAGTCCATATGCTGAAATTTATTTTCACTATGATGTGTCGAGATGATAGCAAGGTTCACGTTATCGTGCGGTTATTGCGCTTACTGCC[G/A]
GGGAGGGGGTCGGTTACCGGTGGTTAGGGTTTGAGAAATTTTGAGCAAATTCAAATTTTTGGAAAAAAATAAAAAAAATCATGGATGTAGTTCTTGATTT

Reverse complement sequence

AAATCAAGAACTACATCCATGATTTTTTTTATTTTTTTCCAAAAATTTGAATTTGCTCAAAATTTCTCAAACCCTAACCACCGGTAACCGACCCCCTCCC[C/T]
GGCAGTAAGCGCAATAACCGCACGATAACGTGAACCTTGCTATCATCTCGACACATCATAGTGAAAATAAATTTCAGCATATGGACTTTTAACCTTATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	7.90%	0.80%	15.70%	NA
All Indica	2759	59.40%	12.80%	1.30%	26.46%	NA
All Japonica	1512	99.10%	0.70%	0.00%	0.26%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	50.80%	2.20%	2.52%	44.54%	NA
Indica II	465	47.70%	1.30%	2.37%	48.60%	NA
Indica III	913	70.20%	26.70%	0.22%	2.85%	NA
Indica Intermediate	786	60.30%	11.60%	1.02%	27.10%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	98.30%	0.80%	0.00%	0.83%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	7.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122960572	G -> A	LOC_Os01g40630.1	upstream_gene_variant ; 1347.0bp to feature; MODIFIER	silent_mutation	Average:57.044; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0122960572	G -> A	LOC_Os01g40630.3	upstream_gene_variant ; 3302.0bp to feature; MODIFIER	silent_mutation	Average:57.044; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0122960572	G -> A	LOC_Os01g40630.2	upstream_gene_variant ; 1427.0bp to feature; MODIFIER	silent_mutation	Average:57.044; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0122960572	G -> A	LOC_Os01g40630-LOC_Os01g40640	intergenic_region ; MODIFIER	silent_mutation	Average:57.044; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg0122960572	G -> DEL	N	N	silent_mutation	Average:57.044; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122960572	1.47E-06	NA	mr1712	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251