\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122959545:

Variant ID: vg0122959545 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22959545
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CACACGTTTGGGAATAGGGGTGAAAACGGATATTTTTTAAAAAAACGGGTGCGGATGCGGAGCGTGTTTCGAATATCGGAAATGGGTGCGGAGCGGTGCG[G/A]
ACTTGGTTCGGAAAAGGATTAAAATTATTGGATGTTATGTATATATACAAGGGACGATATTGATTTAGCAATACAGGGGACAACAATAACGACTCATAAG

Reverse complement sequence

CTTATGAGTCGTTATTGTTGTCCCCTGTATTGCTAAATCAATATCGTCCCTTGTATATATACATAACATCCAATAATTTTAATCCTTTTCCGAACCAAGT[C/T]
CGCACCGCTCCGCACCCATTTCCGATATTCGAAACACGCTCCGCATCCGCACCCGTTTTTTTAAAAAATATCCGTTTTCACCCCTATTCCCAAACGTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.80% 0.11% 0.00% NA
All Indica  2759 83.40% 16.40% 0.18% 0.00% NA
All Japonica  1512 62.40% 37.60% 0.00% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 66.70% 33.10% 0.22% 0.00% NA
Indica III  913 87.70% 12.20% 0.11% 0.00% NA
Indica Intermediate  786 77.20% 22.40% 0.38% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.70% 0.00% 0.00% NA
Japonica Intermediate  241 48.50% 51.50% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122959545 G -> A LOC_Os01g40630.1 upstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:95.136; most accessible tissue: Minghui63 flag leaf, score: 99.161 N N N N
vg0122959545 G -> A LOC_Os01g40630.3 upstream_gene_variant ; 2275.0bp to feature; MODIFIER silent_mutation Average:95.136; most accessible tissue: Minghui63 flag leaf, score: 99.161 N N N N
vg0122959545 G -> A LOC_Os01g40630.2 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:95.136; most accessible tissue: Minghui63 flag leaf, score: 99.161 N N N N
vg0122959545 G -> A LOC_Os01g40630-LOC_Os01g40640 intergenic_region ; MODIFIER silent_mutation Average:95.136; most accessible tissue: Minghui63 flag leaf, score: 99.161 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122959545 G A -0.09 -0.07 -0.09 -0.1 -0.11 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122959545 NA 4.05E-07 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 3.40E-06 3.15E-07 mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 1.33E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 2.06E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 5.34E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 5.17E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 1.21E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 1.47E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 1.14E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 7.16E-06 9.70E-09 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 3.28E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 5.59E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 2.63E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122959545 NA 3.92E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251