\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122939348:

Variant ID: vg0122939348 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22939348
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCAAGCACGCGATCAGCTTTTGTCTTCTAAAGGTATCTGCAAAACCTGTTTCCTTTTCCTCCAAACCTCTCTTCTCCTTCTGCTTTATCTGCAAAGAG[A/C]
GAGAATATCAGGTTCGGATGCCATATGTAGAGAAGCGAAACGGAATTTCAGTAACAAGCGAGCCCGAATCTGAAAGAAAATGATAAACACAGTATCTTTG

Reverse complement sequence

CAAAGATACTGTGTTTATCATTTTCTTTCAGATTCGGGCTCGCTTGTTACTGAAATTCCGTTTCGCTTCTCTACATATGGCATCCGAACCTGATATTCTC[T/G]
CTCTTTGCAGATAAAGCAGAAGGAGAAGAGAGGTTTGGAGGAAAAGGAAACAGGTTTTGCAGATACCTTTAGAAGACAAAAGCTGATCGCGTGCTTGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.40% 0.06% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 48.10% 51.70% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 11.10% 88.70% 0.26% 0.00% NA
Tropical Japonica  504 96.40% 3.40% 0.20% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122939348 A -> C LOC_Os01g40610.1 downstream_gene_variant ; 2076.0bp to feature; MODIFIER silent_mutation Average:44.801; most accessible tissue: Callus, score: 71.01 N N N N
vg0122939348 A -> C LOC_Os01g40610-LOC_Os01g40620 intergenic_region ; MODIFIER silent_mutation Average:44.801; most accessible tissue: Callus, score: 71.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122939348 NA 1.67E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 3.63E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 7.68E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 9.10E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.87E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.14E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.48E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 6.01E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.25E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.03E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 8.05E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 8.84E-13 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 3.43E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 3.69E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.62E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.24E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.54E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 4.68E-06 NA mr1346_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 9.21E-06 2.41E-08 mr1346_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.56E-33 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 6.14E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 5.73E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.64E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 7.17E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 1.04E-07 1.16E-07 mr1577_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 5.75E-07 8.53E-08 mr1577_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 3.49E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 7.89E-06 NA mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.13E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 5.23E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 5.45E-07 4.54E-07 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 6.16E-07 1.84E-08 mr1792_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.92E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 2.25E-08 NA mr1803_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 4.10E-07 6.77E-08 mr1803_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 5.12E-42 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 6.07E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 1.90E-13 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122939348 NA 2.25E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251