\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122924526:

Variant ID: vg0122924526 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 22924526
Reference Allele: TGAlternative Allele: GG,T
Primary Allele: GGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCAAAAGATTGTACTAGTTAAAGGCGGAAAATAAATTATAACGGTATCACTACTATGTTGTTTACAAATGCCTTTTTTTTGGGGTGCGGGTGGAGGGG[TG/GG,T]
CTTATAGCTATCCAATGGATCTATGTGTAAATACTAGAAAATTTTGTCTCCAACCGATATTCCTCGCAAAGCATGTTTATCCATAGAAAGAAGGTGATGA

Reverse complement sequence

TCATCACCTTCTTTCTATGGATAAACATGCTTTGCGAGGAATATCGGTTGGAGACAAAATTTTCTAGTATTTACACATAGATCCATTGGATAGCTATAAG[CA/CC,A]
CCCCTCCACCCGCACCCCAAAAAAAAGGCATTTGTAAACAACATAGTAGTGATACCGTTATAATTTATTTTCCGCCTTTAACTAGTACAATCTTTTGAGA

Allele Frequencies:

Populations Population SizeFrequency of GG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.40% 0.06% 0.00% T: 0.36%
All Indica  2759 98.90% 0.60% 0.00% 0.00% T: 0.51%
All Japonica  1512 42.40% 57.30% 0.13% 0.00% T: 0.13%
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.00% 0.00% T: 0.22%
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 1.40% 0.00% 0.00% T: 1.65%
Temperate Japonica  767 5.20% 94.70% 0.13% 0.00% NA
Tropical Japonica  504 94.20% 5.40% 0.00% 0.00% T: 0.40%
Japonica Intermediate  241 52.30% 47.30% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 1.11% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122924526 TG -> T LOC_Os01g40590.1 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N
vg0122924526 TG -> T LOC_Os01g40600.1 upstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N
vg0122924526 TG -> T LOC_Os01g40590-LOC_Os01g40600 intergenic_region ; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N
vg0122924526 TG -> GG LOC_Os01g40590.1 upstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N
vg0122924526 TG -> GG LOC_Os01g40600.1 upstream_gene_variant ; 4717.0bp to feature; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N
vg0122924526 TG -> GG LOC_Os01g40590-LOC_Os01g40600 intergenic_region ; MODIFIER silent_mutation Average:69.586; most accessible tissue: Callus, score: 90.885 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122924526 TG GG -0.06 -0.02 -0.02 -0.01 -0.02 -0.02
vg0122924526 TG T -0.02 -0.04 -0.07 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122924526 NA 6.47E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.34E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 5.74E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 2.28E-52 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 3.30E-39 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 3.95E-06 3.95E-06 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.14E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 6.87E-12 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 8.71E-06 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 3.66E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.42E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 2.57E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 2.60E-12 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.10E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.71E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 2.34E-15 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.15E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 6.27E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.53E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122924526 NA 1.84E-41 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251