Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122905275:

Variant ID: vg0122905275 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22905275
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGCCGACCATAGGTCCATAGTCGCAATTGGCTCATGTTTTTATATCCCACTACATTCTGGTGTTTTGCAATCCTTAATGGCATCAAGGACACACTAG[G/T]
TTTGTAAGTTAGTTCGTCAGGAAACAAAATAATTAGTGCCTCCTGATGACATAGTTAGTCTGTTTCTGGATAATCATGGAGAAGGATATAGTAGTATACA

Reverse complement sequence

TGTATACTACTATATCCTTCTCCATGATTATCCAGAAACAGACTAACTATGTCATCAGGAGGCACTAATTATTTTGTTTCCTGACGAACTAACTTACAAA[C/A]
CTAGTGTGTCCTTGATGCCATTAAGGATTGCAAAACACCAGAATGTAGTGGGATATAAAAACATGAGCCAATTGCGACTATGGACCTATGGTCGGCTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.40% 0.02% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 62.80% 37.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 15.50% 84.30% 0.20% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122905275 G -> T LOC_Os01g40550.1 upstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:68.606; most accessible tissue: Callus, score: 92.84 N N N N
vg0122905275 G -> T LOC_Os01g40560.1 upstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:68.606; most accessible tissue: Callus, score: 92.84 N N N N
vg0122905275 G -> T LOC_Os01g40540.1 downstream_gene_variant ; 4958.0bp to feature; MODIFIER silent_mutation Average:68.606; most accessible tissue: Callus, score: 92.84 N N N N
vg0122905275 G -> T LOC_Os01g40570.1 downstream_gene_variant ; 2905.0bp to feature; MODIFIER silent_mutation Average:68.606; most accessible tissue: Callus, score: 92.84 N N N N
vg0122905275 G -> T LOC_Os01g40550-LOC_Os01g40560 intergenic_region ; MODIFIER silent_mutation Average:68.606; most accessible tissue: Callus, score: 92.84 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122905275 G T -0.01 -0.01 -0.02 -0.04 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122905275 NA 2.19E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 5.42E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 7.35E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 5.69E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.47E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 5.96E-10 mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.70E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.23E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.52E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.93E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 4.22E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 5.23E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 4.47E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 7.33E-09 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 3.88E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 8.15E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 6.87E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 7.21E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 3.00E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 7.92E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.00E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 2.38E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 7.92E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 1.20E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122905275 NA 3.95E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251