\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122900476:

Variant ID: vg0122900476 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22900476
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGTGACTACTATCCATTCAACTCCCACGTTTCAATCTTCCAGAGAAGGCCTTGAAAGAAGAATGTTCAGACTCCAAAACCATTAACATCGTTTCCAA[C/A]
TTTAGACGATATATTAGAGAATCCAATTTAATAGCACAATTTTTTGGAGCAATGCAGTATAGAGTTGGGCTGAAATAAACAGCTGTTACAAGCTCAAATT

Reverse complement sequence

AATTTGAGCTTGTAACAGCTGTTTATTTCAGCCCAACTCTATACTGCATTGCTCCAAAAAATTGTGCTATTAAATTGGATTCTCTAATATATCGTCTAAA[G/T]
TTGGAAACGATGTTAATGGTTTTGGAGTCTGAACATTCTTCTTTCAAGGCCTTCTCTGGAAGATTGAAACGTGGGAGTTGAATGGATAGTAGTCACAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 19.50% 0.47% 1.25% NA
All Indica  2759 65.90% 32.60% 0.51% 0.98% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 95.20% 2.20% 0.37% 2.23% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 64.90% 32.50% 0.43% 2.15% NA
Indica III  913 45.10% 53.50% 0.44% 0.99% NA
Indica Intermediate  786 66.00% 31.90% 1.02% 1.02% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 67.70% 1.00% 6.25% 25.00% NA
Intermediate  90 81.10% 16.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122900476 C -> A LOC_Os01g40530.1 upstream_gene_variant ; 1633.0bp to feature; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> A LOC_Os01g40499.1 upstream_gene_variant ; 4535.0bp to feature; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> A LOC_Os01g40520.1 downstream_gene_variant ; 3655.0bp to feature; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> A LOC_Os01g40540.1 downstream_gene_variant ; 159.0bp to feature; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> A LOC_Os01g40550.1 downstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> A LOC_Os01g40540-LOC_Os01g40550 intergenic_region ; MODIFIER silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0122900476 C -> DEL N N silent_mutation Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122900476 NA 8.02E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476 NA 3.21E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476 4.91E-06 7.88E-07 mr1723 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476 NA 6.59E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476 NA 8.90E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476 NA 4.22E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251