Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122900476:

Variant ID: vg0122900476 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22900476
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTGTGACTACTATCCATTCAACTCCCACGTTTCAATCTTCCAGAGAAGGCCTTGAAAGAAGAATGTTCAGACTCCAAAACCATTAACATCGTTTCCAA[C/A]
TTTAGACGATATATTAGAGAATCCAATTTAATAGCACAATTTTTTGGAGCAATGCAGTATAGAGTTGGGCTGAAATAAACAGCTGTTACAAGCTCAAATT

Reverse complement sequence

AATTTGAGCTTGTAACAGCTGTTTATTTCAGCCCAACTCTATACTGCATTGCTCCAAAAAATTGTGCTATTAAATTGGATTCTCTAATATATCGTCTAAA[G/T]
TTGGAAACGATGTTAATGGTTTTGGAGTCTGAACATTCTTCTTTCAAGGCCTTCTCTGGAAGATTGAAACGTGGGAGTTGAATGGATAGTAGTCACAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	19.50%	0.47%	1.25%	NA
All Indica	2759	65.90%	32.60%	0.51%	0.98%	NA
All Japonica	1512	99.80%	0.10%	0.00%	0.07%	NA
Aus	269	95.20%	2.20%	0.37%	2.23%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	64.90%	32.50%	0.43%	2.15%	NA
Indica III	913	45.10%	53.50%	0.44%	0.99%	NA
Indica Intermediate	786	66.00%	31.90%	1.02%	1.02%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	67.70%	1.00%	6.25%	25.00%	NA
Intermediate	90	81.10%	16.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122900476	C -> A	LOC_Os01g40530.1	upstream_gene_variant ; 1633.0bp to feature; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> A	LOC_Os01g40499.1	upstream_gene_variant ; 4535.0bp to feature; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> A	LOC_Os01g40520.1	downstream_gene_variant ; 3655.0bp to feature; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> A	LOC_Os01g40540.1	downstream_gene_variant ; 159.0bp to feature; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> A	LOC_Os01g40550.1	downstream_gene_variant ; 491.0bp to feature; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> A	LOC_Os01g40540-LOC_Os01g40550	intergenic_region ; MODIFIER	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0122900476	C -> DEL	N	N	silent_mutation	Average:43.014; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122900476	NA	8.02E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476	NA	3.21E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476	4.91E-06	7.88E-07	mr1723	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476	NA	6.59E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476	NA	8.90E-07	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122900476	NA	4.22E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251