\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122879183:

Variant ID: vg0122879183 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22879183
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCCTTTTTACGGAACATTACACATCAATGCCTCATCAAATTTAGCCTTACATATTTATAAAGTAATCTATCCCATATTAATGGACGTGACTACACAGC[T/C]
AGTGGTAGCTGGTTTGTCTAAATCATCTACCACTTCATCTATAAGAGATACTATCCACCTATACTTCAAATACAATTTTCTCTTAAACTACTCATCCAAT

Reverse complement sequence

ATTGGATGAGTAGTTTAAGAGAAAATTGTATTTGAAGTATAGGTGGATAGTATCTCTTATAGATGAAGTGGTAGATGATTTAGACAAACCAGCTACCACT[A/G]
GCTGTGTAGTCACGTCCATTAATATGGGATAGATTACTTTATAAATATGTAAGGCTAAATTTGATGAGGCATTGATGTGTAATGTTCCGTAAAAAGGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.20% 0.08% 0.00% NA
All Indica  2759 89.70% 10.10% 0.11% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 9.30% 90.30% 0.37% 0.00% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 89.50% 10.50% 0.00% 0.00% NA
Indica Intermediate  786 84.70% 14.90% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122879183 T -> C LOC_Os01g40499.2 downstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:33.603; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0122879183 T -> C LOC_Os01g40499.1 downstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:33.603; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0122879183 T -> C LOC_Os01g40480-LOC_Os01g40499 intergenic_region ; MODIFIER silent_mutation Average:33.603; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122879183 NA 5.01E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.67E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 6.80E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.92E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.85E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.19E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.65E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.08E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 9.87E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 7.34E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.55E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.10E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.07E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 6.77E-08 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 4.13E-06 4.13E-06 mr1331 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 5.05E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.51E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 1.11E-06 4.86E-08 mr1363 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 7.45E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 6.72E-06 mr1371 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.37E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 7.95E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.92E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 6.33E-06 6.31E-06 mr1421 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 9.11E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.61E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 8.25E-07 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 8.25E-07 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.06E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.53E-18 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.29E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 3.53E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 1.13E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 5.42E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 3.44E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.53E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.88E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 2.02E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 7.13E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.14E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 3.45E-06 3.45E-06 mr1674 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 4.24E-06 4.24E-06 mr1674 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 4.56E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 5.36E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 3.18E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 5.54E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 6.60E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 6.36E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 8.94E-13 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122879183 NA 9.04E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251