Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122875553:

Variant ID: vg0122875553 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 22875553
Reference Allele: A	Alternative Allele: C,AT
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCATTTCACCAACTAAACAGGCCCTAAAACAGTACTCTAGAACGGAGATGATGATATCTACTACTCCCTCCGTCCCATAATATAAGAGATTTTAAC[A/C,AT]
TTTTGCTTTTATTGTTTGATCACTCGTCTTATTAAAAAAATTTGTGTAAATATAAAAAAATAAAAAATTGTGCTTAAAGTACTTTAGATAATAAAGAAAG

Reverse complement sequence

CTTTCTTTATTATCTAAAGTACTTTAAGCACAATTTTTTATTTTTTTATATTTACACAAATTTTTTTAATAAGACGAGTGATCAAACAATAAAAGCAAAA[T/G,AT]
GTTAAAATCTCTTATATTATGGGACGGAGGGAGTAGTAGATATCATCATCTCCGTTCTAGAGTACTGTTTTAGGGCCTGTTTAGTTGGTGAAATGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	19.40%	0.00%	0.00%	AT: 0.04%
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	42.70%	57.20%	0.00%	0.00%	AT: 0.13%
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	4.80%	95.20%	0.00%	0.00%	NA
Tropical Japonica	504	94.40%	5.60%	0.00%	0.00%	NA
Japonica Intermediate	241	54.80%	44.40%	0.00%	0.00%	AT: 0.83%
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122875553	A -> C	LOC_Os01g40480.1	upstream_gene_variant ; 3404.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> C	LOC_Os01g40499.2	downstream_gene_variant ; 4351.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> C	LOC_Os01g40499.1	downstream_gene_variant ; 4351.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> C	LOC_Os01g40480-LOC_Os01g40499	intergenic_region ; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> AT	LOC_Os01g40480.1	upstream_gene_variant ; 3405.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> AT	LOC_Os01g40499.2	downstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> AT	LOC_Os01g40499.1	downstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0122875553	A -> AT	LOC_Os01g40480-LOC_Os01g40499	intergenic_region ; MODIFIER	silent_mutation	Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122875553	NA	9.37E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.53E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.13E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.07E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	8.79E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.86E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	3.26E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	7.27E-06	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	2.97E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	3.33E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.42E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.17E-06	mr1405	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	8.12E-37	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	2.27E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.06E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	7.54E-09	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.63E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.97E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.44E-08	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.80E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	8.14E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	8.02E-09	3.50E-39	mr1789	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.82E-15	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	6.47E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.38E-12	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.55E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.68E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	2.03E-23	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	7.47E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	6.19E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	6.33E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	8.81E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.44E-08	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.83E-18	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	2.19E-18	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	9.73E-08	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	2.95E-17	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.63E-31	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	4.40E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	9.38E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	5.94E-13	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553	NA	1.81E-09	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251