\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122875553:

Variant ID: vg0122875553 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 22875553
Reference Allele: AAlternative Allele: C,AT
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCATTTCACCAACTAAACAGGCCCTAAAACAGTACTCTAGAACGGAGATGATGATATCTACTACTCCCTCCGTCCCATAATATAAGAGATTTTAAC[A/C,AT]
TTTTGCTTTTATTGTTTGATCACTCGTCTTATTAAAAAAATTTGTGTAAATATAAAAAAATAAAAAATTGTGCTTAAAGTACTTTAGATAATAAAGAAAG

Reverse complement sequence

CTTTCTTTATTATCTAAAGTACTTTAAGCACAATTTTTTATTTTTTTATATTTACACAAATTTTTTTAATAAGACGAGTGATCAAACAATAAAAGCAAAA[T/G,AT]
GTTAAAATCTCTTATATTATGGGACGGAGGGAGTAGTAGATATCATCATCTCCGTTCTAGAGTACTGTTTTAGGGCCTGTTTAGTTGGTGAAATGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.40% 0.00% 0.00% AT: 0.04%
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 42.70% 57.20% 0.00% 0.00% AT: 0.13%
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 54.80% 44.40% 0.00% 0.00% AT: 0.83%
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122875553 A -> C LOC_Os01g40480.1 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> C LOC_Os01g40499.2 downstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> C LOC_Os01g40499.1 downstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> C LOC_Os01g40480-LOC_Os01g40499 intergenic_region ; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> AT LOC_Os01g40480.1 upstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> AT LOC_Os01g40499.2 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> AT LOC_Os01g40499.1 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0122875553 A -> AT LOC_Os01g40480-LOC_Os01g40499 intergenic_region ; MODIFIER silent_mutation Average:49.01; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122875553 NA 9.37E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.53E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.13E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.07E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 8.79E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.86E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 3.26E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 7.27E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 2.97E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 3.33E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.42E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.17E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 8.12E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 2.27E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.06E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 7.54E-09 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.63E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.97E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.44E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.80E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 8.14E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 8.02E-09 3.50E-39 mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.82E-15 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 6.47E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.38E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.55E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.68E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 2.03E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 7.47E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 6.19E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 6.33E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 8.81E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.44E-08 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.83E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 2.19E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 9.73E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 2.95E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.63E-31 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 4.40E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 9.38E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 5.94E-13 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122875553 NA 1.81E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251