\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122848570:

Variant ID: vg0122848570 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22848570
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACCCACATAGCATGTGCACTCTTGAGATTGCATACTTCATTAAACATGTCATCACTCAAAACACAAAATAAAGCATTAGTAGCTTGAGCATCGAGAT[A/G]
TAGGCATTTCTCTTGCCCACTTGTTGGAGCACGGTCATCCAAAGCATGAGAAAAGCCCACATCTACAATTCACCATATTTTTGGGCTCATGGCCCTAAAA

Reverse complement sequence

TTTTAGGGCCATGAGCCCAAAAATATGGTGAATTGTAGATGTGGGCTTTTCTCATGCTTTGGATGACCGTGCTCCAACAAGTGGGCAAGAGAAATGCCTA[T/C]
ATCTCGATGCTCAAGCTACTAATGCTTTATTTTGTGTTTTGAGTGATGACATGTTTAATGAAGTATGCAATCTCAAGAGTGCACATGCTATGTGGGTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 0.20% 37.41% 30.41% NA
All Indica  2759 3.30% 0.10% 47.15% 49.47% NA
All Japonica  1512 90.90% 0.00% 6.75% 2.38% NA
Aus  269 2.20% 1.10% 89.59% 7.06% NA
Indica I  595 3.40% 0.00% 25.55% 71.09% NA
Indica II  465 2.60% 0.00% 31.83% 65.59% NA
Indica III  913 1.50% 0.00% 71.52% 26.94% NA
Indica Intermediate  786 5.70% 0.30% 44.27% 49.75% NA
Temperate Japonica  767 99.30% 0.00% 0.26% 0.39% NA
Tropical Japonica  504 79.20% 0.00% 15.28% 5.56% NA
Japonica Intermediate  241 88.40% 0.00% 9.54% 2.07% NA
VI/Aromatic  96 2.10% 1.00% 95.83% 1.04% NA
Intermediate  90 44.40% 2.20% 35.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122848570 A -> G LOC_Os01g40460.1 missense_variant ; p.Tyr44His; MODERATE nonsynonymous_codon ; Y44H Average:14.668; most accessible tissue: Callus, score: 34.143 unknown unknown TOLERATED 1.00
vg0122848570 A -> DEL LOC_Os01g40460.1 N frameshift_variant Average:14.668; most accessible tissue: Callus, score: 34.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122848570 NA 3.34E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 8.19E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 9.82E-07 9.16E-10 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 1.39E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 4.45E-15 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 7.36E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 4.37E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 2.94E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 1.77E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 7.38E-07 1.34E-09 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 6.62E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 7.54E-16 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 5.11E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 7.10E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 3.62E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 2.57E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 5.15E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 1.30E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 9.66E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 3.72E-13 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 7.55E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 3.38E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 2.30E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 2.53E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 1.13E-13 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 NA 1.43E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122848570 6.90E-07 2.07E-31 mr1913_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251