| Variant ID: vg0122848570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22848570 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 81. )
TTTACCCACATAGCATGTGCACTCTTGAGATTGCATACTTCATTAAACATGTCATCACTCAAAACACAAAATAAAGCATTAGTAGCTTGAGCATCGAGAT[A/G]
TAGGCATTTCTCTTGCCCACTTGTTGGAGCACGGTCATCCAAAGCATGAGAAAAGCCCACATCTACAATTCACCATATTTTTGGGCTCATGGCCCTAAAA
TTTTAGGGCCATGAGCCCAAAAATATGGTGAATTGTAGATGTGGGCTTTTCTCATGCTTTGGATGACCGTGCTCCAACAAGTGGGCAAGAGAAATGCCTA[T/C]
ATCTCGATGCTCAAGCTACTAATGCTTTATTTTGTGTTTTGAGTGATGACATGTTTAATGAAGTATGCAATCTCAAGAGTGCACATGCTATGTGGGTAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.00% | 0.20% | 37.41% | 30.41% | NA |
| All Indica | 2759 | 3.30% | 0.10% | 47.15% | 49.47% | NA |
| All Japonica | 1512 | 90.90% | 0.00% | 6.75% | 2.38% | NA |
| Aus | 269 | 2.20% | 1.10% | 89.59% | 7.06% | NA |
| Indica I | 595 | 3.40% | 0.00% | 25.55% | 71.09% | NA |
| Indica II | 465 | 2.60% | 0.00% | 31.83% | 65.59% | NA |
| Indica III | 913 | 1.50% | 0.00% | 71.52% | 26.94% | NA |
| Indica Intermediate | 786 | 5.70% | 0.30% | 44.27% | 49.75% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 79.20% | 0.00% | 15.28% | 5.56% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.00% | 9.54% | 2.07% | NA |
| VI/Aromatic | 96 | 2.10% | 1.00% | 95.83% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 2.20% | 35.56% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122848570 | A -> G | LOC_Os01g40460.1 | missense_variant ; p.Tyr44His; MODERATE | nonsynonymous_codon ; Y44H | Average:14.668; most accessible tissue: Callus, score: 34.143 | unknown | unknown | TOLERATED | 1.00 |
| vg0122848570 | A -> DEL | LOC_Os01g40460.1 | N | frameshift_variant | Average:14.668; most accessible tissue: Callus, score: 34.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122848570 | NA | 3.34E-08 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 8.19E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | 9.82E-07 | 9.16E-10 | mr1116 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 1.39E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 4.45E-15 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 7.36E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 4.37E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 2.94E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | NA | 1.77E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122848570 | 7.38E-07 | 1.34E-09 | mr1247 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/