\
| Variant ID: vg0122825377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22825377 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 100. )
CTTGCGCCATTGACAACCGTCCTTCACCTGTGAGATAAAATTCAAAAATAAATCAGCTCATCTATACCATTGTACTCCCTCCTTCTCTAAATGTCTGACG[C/T]
CGTTGACTTTTTTAAACATATTTGACCGTTCGTCTTATTCAAAAACTTTTATGAAATGTGTAAAACTATATGTATACATAAAAATATATTTAAGAATAAA
TTTATTCTTAAATATATTTTTATGTATACATATAGTTTTACACATTTCATAAAAGTTTTTGAATAAGACGAACGGTCAAATATGTTTAAAAAAGTCAACG[G/A]
CGTCAGACATTTAGAGAAGGAGGGAGTACAATGGTATAGATGAGCTGATTTATTTTTGAATTTTATCTCACAGGTGAAGGACGGTTGTCAATGGCGCAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 25.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 74.80% | 25.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.50% | 45.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 26.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122825377 | C -> T | LOC_Os01g40420.1 | upstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 | N | N | N | N |
| vg0122825377 | C -> T | LOC_Os01g40420.2 | upstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 | N | N | N | N |
| vg0122825377 | C -> T | LOC_Os01g40420.3 | upstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 | N | N | N | N |
| vg0122825377 | C -> T | LOC_Os01g40430.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122825377 | NA | 2.10E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 2.11E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 6.48E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 2.09E-07 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 2.82E-07 | mr1677 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 9.96E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 6.82E-07 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122825377 | NA | 8.85E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |