Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122825377:

Variant ID: vg0122825377 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22825377
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGCGCCATTGACAACCGTCCTTCACCTGTGAGATAAAATTCAAAAATAAATCAGCTCATCTATACCATTGTACTCCCTCCTTCTCTAAATGTCTGACG[C/T]
CGTTGACTTTTTTAAACATATTTGACCGTTCGTCTTATTCAAAAACTTTTATGAAATGTGTAAAACTATATGTATACATAAAAATATATTTAAGAATAAA

Reverse complement sequence

TTTATTCTTAAATATATTTTTATGTATACATATAGTTTTACACATTTCATAAAAGTTTTTGAATAAGACGAACGGTCAAATATGTTTAAAAAAGTCAACG[G/A]
CGTCAGACATTTAGAGAAGGAGGGAGTACAATGGTATAGATGAGCTGATTTATTTTTGAATTTTATCTCACAGGTGAAGGACGGTTGTCAATGGCGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	25.30%	0.13%	0.00%	NA
All Indica	2759	74.80%	25.00%	0.22%	0.00%	NA
All Japonica	1512	91.10%	8.90%	0.00%	0.00%	NA
Aus	269	4.10%	95.90%	0.00%	0.00%	NA
Indica I	595	54.50%	45.20%	0.34%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	80.40%	19.60%	0.00%	0.00%	NA
Indica Intermediate	786	72.60%	26.80%	0.51%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	79.20%	20.80%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122825377	C -> T	LOC_Os01g40420.1	upstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0122825377	C -> T	LOC_Os01g40420.2	upstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0122825377	C -> T	LOC_Os01g40420.3	upstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N
vg0122825377	C -> T	LOC_Os01g40430.1	intron_variant ; MODIFIER	silent_mutation	Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122825377	NA	2.10E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	2.11E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	6.48E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	2.09E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	2.82E-07	mr1677	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	9.96E-07	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	6.82E-07	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377	NA	8.85E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251