\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122825377:

Variant ID: vg0122825377 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22825377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCGCCATTGACAACCGTCCTTCACCTGTGAGATAAAATTCAAAAATAAATCAGCTCATCTATACCATTGTACTCCCTCCTTCTCTAAATGTCTGACG[C/T]
CGTTGACTTTTTTAAACATATTTGACCGTTCGTCTTATTCAAAAACTTTTATGAAATGTGTAAAACTATATGTATACATAAAAATATATTTAAGAATAAA

Reverse complement sequence

TTTATTCTTAAATATATTTTTATGTATACATATAGTTTTACACATTTCATAAAAGTTTTTGAATAAGACGAACGGTCAAATATGTTTAAAAAAGTCAACG[G/A]
CGTCAGACATTTAGAGAAGGAGGGAGTACAATGGTATAGATGAGCTGATTTATTTTTGAATTTTATCTCACAGGTGAAGGACGGTTGTCAATGGCGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.30% 0.13% 0.00% NA
All Indica  2759 74.80% 25.00% 0.22% 0.00% NA
All Japonica  1512 91.10% 8.90% 0.00% 0.00% NA
Aus  269 4.10% 95.90% 0.00% 0.00% NA
Indica I  595 54.50% 45.20% 0.34% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 80.40% 19.60% 0.00% 0.00% NA
Indica Intermediate  786 72.60% 26.80% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 79.20% 20.80% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122825377 C -> T LOC_Os01g40420.1 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0122825377 C -> T LOC_Os01g40420.2 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0122825377 C -> T LOC_Os01g40420.3 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N
vg0122825377 C -> T LOC_Os01g40430.1 intron_variant ; MODIFIER silent_mutation Average:67.844; most accessible tissue: Zhenshan97 root, score: 85.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122825377 NA 2.10E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 2.11E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 6.48E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 2.09E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 2.82E-07 mr1677 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 9.96E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 6.82E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122825377 NA 8.85E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251