Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122800847:

Variant ID: vg0122800847 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22800847
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAACGCTCTATGGTTTGAGATAATTTAATATGCAACTTCTTCCTAAGGGTTGCTCTACTATTTGGAAATAATTCAACATGAACATCCCAAGGCCGCTA[T/C]
GGTTTTTAGATAATACATTGAATTGATAATTGCATTTTGTAATTTGATTTGCGTATGCGTAATCCTCAAGGTATCTCCACGTATAACTAATCTATCATCC

Reverse complement sequence

GGATGATAGATTAGTTATACGTGGAGATACCTTGAGGATTACGCATACGCAAATCAAATTACAAAATGCAATTATCAATTCAATGTATTATCTAAAAACC[A/G]
TAGCGGCCTTGGGATGTTCATGTTGAATTATTTCCAAATAGTAGAGCAACCCTTAGGAAGAAGTTGCATATTAAATTATCTCAAACCATAGAGCGTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	13.20%	1.69%	0.00%	NA
All Indica	2759	95.60%	3.80%	0.58%	0.00%	NA
All Japonica	1512	62.50%	33.30%	4.17%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.90%	6.90%	1.18%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	4.80%	1.15%	0.00%	NA
Temperate Japonica	767	35.50%	59.20%	5.35%	0.00%	NA
Tropical Japonica	504	97.20%	1.40%	1.39%	0.00%	NA
Japonica Intermediate	241	75.90%	17.80%	6.22%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122800847	T -> C	LOC_Os01g40380.1	downstream_gene_variant ; 1881.0bp to feature; MODIFIER	silent_mutation	Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0122800847	T -> C	LOC_Os01g40390.1	downstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0122800847	T -> C	LOC_Os01g40380-LOC_Os01g40390	intergenic_region ; MODIFIER	silent_mutation	Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122800847	NA	1.84E-09	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	3.90E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	3.96E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	5.72E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	3.32E-08	5.99E-18	mr1002_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	4.19E-13	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	1.16E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	2.52E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	8.26E-14	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	5.06E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	4.72E-16	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	8.04E-17	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	9.41E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	3.39E-12	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	9.63E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	6.25E-08	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	2.80E-06	NA	mr1548_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	1.88E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847	NA	4.79E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251