\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122800847:

Variant ID: vg0122800847 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22800847
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAACGCTCTATGGTTTGAGATAATTTAATATGCAACTTCTTCCTAAGGGTTGCTCTACTATTTGGAAATAATTCAACATGAACATCCCAAGGCCGCTA[T/C]
GGTTTTTAGATAATACATTGAATTGATAATTGCATTTTGTAATTTGATTTGCGTATGCGTAATCCTCAAGGTATCTCCACGTATAACTAATCTATCATCC

Reverse complement sequence

GGATGATAGATTAGTTATACGTGGAGATACCTTGAGGATTACGCATACGCAAATCAAATTACAAAATGCAATTATCAATTCAATGTATTATCTAAAAACC[A/G]
TAGCGGCCTTGGGATGTTCATGTTGAATTATTTCCAAATAGTAGAGCAACCCTTAGGAAGAAGTTGCATATTAAATTATCTCAAACCATAGAGCGTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 13.20% 1.69% 0.00% NA
All Indica  2759 95.60% 3.80% 0.58% 0.00% NA
All Japonica  1512 62.50% 33.30% 4.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.90% 6.90% 1.18% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 97.90% 2.10% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 4.80% 1.15% 0.00% NA
Temperate Japonica  767 35.50% 59.20% 5.35% 0.00% NA
Tropical Japonica  504 97.20% 1.40% 1.39% 0.00% NA
Japonica Intermediate  241 75.90% 17.80% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122800847 T -> C LOC_Os01g40380.1 downstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg0122800847 T -> C LOC_Os01g40390.1 downstream_gene_variant ; 2839.0bp to feature; MODIFIER silent_mutation Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg0122800847 T -> C LOC_Os01g40380-LOC_Os01g40390 intergenic_region ; MODIFIER silent_mutation Average:25.645; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122800847 NA 1.84E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 3.90E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 3.96E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 5.72E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 3.32E-08 5.99E-18 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 4.19E-13 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 1.16E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 2.52E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 8.26E-14 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 5.06E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 4.72E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 8.04E-17 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 9.41E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 3.39E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 9.63E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 6.25E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 2.80E-06 NA mr1548_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 1.88E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122800847 NA 4.79E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251