\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122754153:

Variant ID: vg0122754153 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22754153
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTGATTTATTTTTTTAATCTTTAGCATGTTTTGAGTTTGAAAGTTTTTAAATTTTAAGTTGAAAATTTTCAAATCTGAACTTAAAAGTTTTTAAATCT[C/T]
GACTTGAAAGTTTTCAAAATTTTCAAATCTAGACTTGAAAGTTTTTGAATCTCGAGTTGAAAGTTTTCAAATCTCAAATTGAAAGTTTTCAAATTTTTTC

Reverse complement sequence

GAAAAAATTTGAAAACTTTCAATTTGAGATTTGAAAACTTTCAACTCGAGATTCAAAAACTTTCAAGTCTAGATTTGAAAATTTTGAAAACTTTCAAGTC[G/A]
AGATTTAAAAACTTTTAAGTTCAGATTTGAAAATTTTCAACTTAAAATTTAAAAACTTTCAAACTCAAAACATGCTAAAGATTAAAAAAATAAATCAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.70% 0.85% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 92.30% 5.10% 2.58% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 4.20% 2.35% 0.00% NA
Tropical Japonica  504 96.80% 2.40% 0.79% 0.00% NA
Japonica Intermediate  241 79.30% 13.70% 7.05% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122754153 C -> T LOC_Os01g40320.1 upstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:44.245; most accessible tissue: Minghui63 flower, score: 85.0 N N N N
vg0122754153 C -> T LOC_Os01g40310.1 downstream_gene_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:44.245; most accessible tissue: Minghui63 flower, score: 85.0 N N N N
vg0122754153 C -> T LOC_Os01g40290-LOC_Os01g40310 intergenic_region ; MODIFIER silent_mutation Average:44.245; most accessible tissue: Minghui63 flower, score: 85.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122754153 NA 3.34E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 2.64E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 7.25E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 1.43E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 2.64E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 3.62E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 5.55E-08 1.70E-08 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 6.66E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 3.62E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 5.64E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 2.75E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 1.76E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 3.07E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122754153 NA 3.39E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251