\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122697050:

Variant ID: vg0122697050 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22697050
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATGTCATACTTAAAGAACATTTGATGATGCATCAAGTCACCATAAAATAAATAATAATTATATAATTTTTTTAAATAAAACGAATGGTCAAACGTTG[G/A]
ATAAAAAGTCAACAGCGTCATACATTAAAATATAAAATATAAGGTAGTATCAACCAAGCACACCATTAACAACACATCCTCTACCAAAATTTGTTAATTT

Reverse complement sequence

AAATTAACAAATTTTGGTAGAGGATGTGTTGTTAATGGTGTGCTTGGTTGATACTACCTTATATTTTATATTTTAATGTATGACGCTGTTGACTTTTTAT[C/T]
CAACGTTTGACCATTCGTTTTATTTAAAAAAATTATATAATTATTATTTATTTTATGGTGACTTGATGCATCATCAAATGTTCTTTAAGTATGACATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 1.90% 14.71% 6.86% NA
All Indica  2759 85.60% 1.10% 9.57% 3.73% NA
All Japonica  1512 76.20% 0.40% 12.76% 10.65% NA
Aus  269 7.80% 10.00% 62.08% 20.07% NA
Indica I  595 91.10% 0.30% 8.57% 0.00% NA
Indica II  465 89.50% 0.00% 4.95% 5.59% NA
Indica III  913 84.20% 1.60% 9.86% 4.27% NA
Indica Intermediate  786 80.70% 1.80% 12.72% 4.83% NA
Temperate Japonica  767 73.10% 0.00% 13.82% 13.04% NA
Tropical Japonica  504 76.60% 1.00% 14.09% 8.33% NA
Japonica Intermediate  241 85.10% 0.40% 6.64% 7.88% NA
VI/Aromatic  96 13.50% 26.00% 60.42% 0.00% NA
Intermediate  90 75.60% 3.30% 14.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122697050 G -> A LOC_Os01g40230.1 upstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg0122697050 G -> A LOC_Os01g40210.1 downstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg0122697050 G -> A LOC_Os01g40220.1 downstream_gene_variant ; 1384.0bp to feature; MODIFIER silent_mutation Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg0122697050 G -> A LOC_Os01g40220-LOC_Os01g40230 intergenic_region ; MODIFIER silent_mutation Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg0122697050 G -> DEL N N silent_mutation Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122697050 NA 4.21E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 3.24E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 1.98E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 7.46E-06 mr1217 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 9.79E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 3.37E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 5.80E-06 5.80E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 4.25E-08 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 1.63E-07 1.63E-07 mr1331 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 3.57E-06 3.57E-06 mr1362 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 8.79E-06 4.17E-07 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 9.72E-06 1.58E-07 mr1371 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 9.45E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 3.61E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 9.40E-06 9.40E-06 mr1488 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 7.42E-06 7.41E-06 mr1529 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 1.10E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 5.92E-11 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 6.85E-07 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 3.50E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 1.11E-06 1.11E-06 mr1674 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 1.00E-06 mr1689 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 7.44E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 7.65E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 3.48E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050 NA 1.41E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251