Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122697050:

Variant ID: vg0122697050 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22697050
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATGTCATACTTAAAGAACATTTGATGATGCATCAAGTCACCATAAAATAAATAATAATTATATAATTTTTTTAAATAAAACGAATGGTCAAACGTTG[G/A]
ATAAAAAGTCAACAGCGTCATACATTAAAATATAAAATATAAGGTAGTATCAACCAAGCACACCATTAACAACACATCCTCTACCAAAATTTGTTAATTT

Reverse complement sequence

AAATTAACAAATTTTGGTAGAGGATGTGTTGTTAATGGTGTGCTTGGTTGATACTACCTTATATTTTATATTTTAATGTATGACGCTGTTGACTTTTTAT[C/T]
CAACGTTTGACCATTCGTTTTATTTAAAAAAATTATATAATTATTATTTATTTTATGGTGACTTGATGCATCATCAAATGTTCTTTAAGTATGACATAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	1.90%	14.71%	6.86%	NA
All Indica	2759	85.60%	1.10%	9.57%	3.73%	NA
All Japonica	1512	76.20%	0.40%	12.76%	10.65%	NA
Aus	269	7.80%	10.00%	62.08%	20.07%	NA
Indica I	595	91.10%	0.30%	8.57%	0.00%	NA
Indica II	465	89.50%	0.00%	4.95%	5.59%	NA
Indica III	913	84.20%	1.60%	9.86%	4.27%	NA
Indica Intermediate	786	80.70%	1.80%	12.72%	4.83%	NA
Temperate Japonica	767	73.10%	0.00%	13.82%	13.04%	NA
Tropical Japonica	504	76.60%	1.00%	14.09%	8.33%	NA
Japonica Intermediate	241	85.10%	0.40%	6.64%	7.88%	NA
VI/Aromatic	96	13.50%	26.00%	60.42%	0.00%	NA
Intermediate	90	75.60%	3.30%	14.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122697050	G -> A	LOC_Os01g40230.1	upstream_gene_variant ; 1371.0bp to feature; MODIFIER	silent_mutation	Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551	N	N	N	N
vg0122697050	G -> A	LOC_Os01g40210.1	downstream_gene_variant ; 3337.0bp to feature; MODIFIER	silent_mutation	Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551	N	N	N	N
vg0122697050	G -> A	LOC_Os01g40220.1	downstream_gene_variant ; 1384.0bp to feature; MODIFIER	silent_mutation	Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551	N	N	N	N
vg0122697050	G -> A	LOC_Os01g40220-LOC_Os01g40230	intergenic_region ; MODIFIER	silent_mutation	Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551	N	N	N	N
vg0122697050	G -> DEL	N	N	silent_mutation	Average:51.59; most accessible tissue: Zhenshan97 root, score: 88.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122697050	NA	4.21E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	3.24E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	1.98E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	7.46E-06	mr1217	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	9.79E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	3.37E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	5.80E-06	5.80E-06	mr1275	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	4.25E-08	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	1.63E-07	1.63E-07	mr1331	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	3.57E-06	3.57E-06	mr1362	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	8.79E-06	4.17E-07	mr1363	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	9.72E-06	1.58E-07	mr1371	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	9.45E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	3.61E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	9.40E-06	9.40E-06	mr1488	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	7.42E-06	7.41E-06	mr1529	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	1.10E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	5.92E-11	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	6.85E-07	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	3.50E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	1.11E-06	1.11E-06	mr1674	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	1.00E-06	mr1689	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	7.44E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	7.65E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	3.48E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122697050	NA	1.41E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251