Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122694254:

Variant ID: vg0122694254 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22694254
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGAGAGAGATTTTGTGTAGGGTGGGGAGCGAGTATGGACAAGGACGGGACGCGTTTGGCTCGTCTTAGTTTTTCTGGTGTCATTTTTTTTAAAAAAAA[C/A,T]
CAATATTTATAATATAGGTGTCGGTTTTGTTTAAAATCGGCTCCTATAATTCCTGAAATGTGCTAATTCTGTAATTTTTCCACCCCCCGCATAGGTGGGA

Reverse complement sequence

TCCCACCTATGCGGGGGGTGGAAAAATTACAGAATTAGCACATTTCAGGAATTATAGGAGCCGATTTTAAACAAAACCGACACCTATATTATAAATATTG[G/T,A]
TTTTTTTTAAAAAAAATGACACCAGAAAAACTAAGACGAGCCAAACGCGTCCCGTCCTTGTCCATACTCGCTCCCCACCCTACACAAAATCTCTCTCACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	20.90%	0.49%	0.00%	NA
All Indica	2759	75.90%	23.60%	0.43%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	9.30%	88.10%	2.60%	0.00%	NA
Indica I	595	93.40%	6.10%	0.50%	0.00%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	58.70%	40.90%	0.44%	0.00%	NA
Indica Intermediate	786	71.40%	28.00%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	78.10%	3.12%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122694254	C -> T	LOC_Os01g40220.1	upstream_gene_variant ; 1027.0bp to feature; MODIFIER	N	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> T	LOC_Os01g40230.1	upstream_gene_variant ; 4167.0bp to feature; MODIFIER	N	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> T	LOC_Os01g40210.1	downstream_gene_variant ; 541.0bp to feature; MODIFIER	N	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> T	LOC_Os01g40210-LOC_Os01g40220	intergenic_region ; MODIFIER	N	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> A	LOC_Os01g40220.1	upstream_gene_variant ; 1027.0bp to feature; MODIFIER	silent_mutation	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> A	LOC_Os01g40230.1	upstream_gene_variant ; 4167.0bp to feature; MODIFIER	silent_mutation	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> A	LOC_Os01g40210.1	downstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0122694254	C -> A	LOC_Os01g40210-LOC_Os01g40220	intergenic_region ; MODIFIER	silent_mutation	Average:61.843; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122694254	NA	7.85E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.09E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.23E-09	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	9.93E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	4.82E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	4.89E-08	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	2.96E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	5.24E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	6.65E-09	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.64E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.91E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	4.92E-11	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	8.28E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.53E-09	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	2.07E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	3.21E-06	mr1474	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	3.21E-06	mr1475	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	3.14E-06	mr1734	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	5.67E-07	3.33E-08	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	4.35E-06	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694254	NA	1.34E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251