Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122694221:

Variant ID: vg0122694221 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22694221
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGAGGGGCGGGGGAGAGTGAGAGAGAGCGAGAGTGAGAGAGATTTTGTGTAGGGTGGGGAGCGAGTATGGACAAGGACGGGACGCGTTTGGCTCGTCT[T/C]
AGTTTTTCTGGTGTCATTTTTTTTAAAAAAAACCAATATTTATAATATAGGTGTCGGTTTTGTTTAAAATCGGCTCCTATAATTCCTGAAATGTGCTAAT

Reverse complement sequence

ATTAGCACATTTCAGGAATTATAGGAGCCGATTTTAAACAAAACCGACACCTATATTATAAATATTGGTTTTTTTTAAAAAAAATGACACCAGAAAAACT[A/G]
AGACGAGCCAAACGCGTCCCGTCCTTGTCCATACTCGCTCCCCACCCTACACAAAATCTCTCTCACTCTCGCTCTCTCTCACTCTCCCCCGCCCCTCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	44.40%	0.08%	0.00%	NA
All Indica	2759	76.10%	23.80%	0.07%	0.00%	NA
All Japonica	1512	9.70%	90.30%	0.00%	0.00%	NA
Aus	269	95.50%	4.10%	0.37%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	64.10%	35.90%	0.00%	0.00%	NA
Indica III	913	67.50%	32.30%	0.22%	0.00%	NA
Indica Intermediate	786	76.70%	23.30%	0.00%	0.00%	NA
Temperate Japonica	767	4.00%	96.00%	0.00%	0.00%	NA
Tropical Japonica	504	19.20%	80.80%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122694221	T -> C	LOC_Os01g40220.1	upstream_gene_variant ; 1060.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0122694221	T -> C	LOC_Os01g40230.1	upstream_gene_variant ; 4200.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0122694221	T -> C	LOC_Os01g40210.1	downstream_gene_variant ; 508.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0122694221	T -> C	LOC_Os01g40210-LOC_Os01g40220	intergenic_region ; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122694221	NA	3.43E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	8.95E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	3.66E-06	1.71E-18	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	3.08E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.33E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	5.62E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.02E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	3.40E-15	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	4.05E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.60E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.58E-06	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	9.67E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.42E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	1.34E-09	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	7.61E-06	3.38E-13	mr1744	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	8.92E-06	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	3.07E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	3.10E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	2.84E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	3.49E-26	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	2.60E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	8.81E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	9.82E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	2.00E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	2.76E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	6.00E-06	NA	mr1750_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	5.06E-10	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694221	NA	6.61E-09	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251