\
| Variant ID: vg0122694201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22694201 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.14, others allele: 0.00, population size: 94. )
AGCATGAGGGGGCGGAGGGAGAGGAGGGGCGGGGGAGAGTGAGAGAGAGCGAGAGTGAGAGAGATTTTGTGTAGGGTGGGGAGCGAGTATGGACAAGGAC[G/A]
GGACGCGTTTGGCTCGTCTTAGTTTTTCTGGTGTCATTTTTTTTAAAAAAAACCAATATTTATAATATAGGTGTCGGTTTTGTTTAAAATCGGCTCCTAT
ATAGGAGCCGATTTTAAACAAAACCGACACCTATATTATAAATATTGGTTTTTTTTAAAAAAAATGACACCAGAAAAACTAAGACGAGCCAAACGCGTCC[C/T]
GTCCTTGTCCATACTCGCTCCCCACCCTACACAAAATCTCTCTCACTCTCGCTCTCTCTCACTCTCCCCCGCCCCTCCTCTCCCTCCGCCCCCTCATGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.00% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 75.10% | 24.50% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 6.90% | 93.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 90.30% | 7.80% | 1.86% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 63.20% | 36.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 66.30% | 32.90% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 75.40% | 24.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.80% | 81.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 60.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122694201 | G -> A | LOC_Os01g40220.1 | upstream_gene_variant ; 1080.0bp to feature; MODIFIER | silent_mutation | Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0122694201 | G -> A | LOC_Os01g40230.1 | upstream_gene_variant ; 4220.0bp to feature; MODIFIER | silent_mutation | Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0122694201 | G -> A | LOC_Os01g40210.1 | downstream_gene_variant ; 488.0bp to feature; MODIFIER | silent_mutation | Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0122694201 | G -> A | LOC_Os01g40210-LOC_Os01g40220 | intergenic_region ; MODIFIER | silent_mutation | Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122694201 | NA | 1.52E-11 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 8.20E-17 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | 7.64E-06 | 1.96E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 4.25E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | 8.81E-06 | 3.60E-06 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 1.82E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | 9.50E-06 | 8.58E-07 | mr1346 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 7.43E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | 5.51E-06 | 4.73E-07 | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 1.27E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | 3.45E-06 | 5.19E-06 | mr1744 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122694201 | NA | 3.31E-07 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |