\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122694201:

Variant ID: vg0122694201 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22694201
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.14, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGCATGAGGGGGCGGAGGGAGAGGAGGGGCGGGGGAGAGTGAGAGAGAGCGAGAGTGAGAGAGATTTTGTGTAGGGTGGGGAGCGAGTATGGACAAGGAC[G/A]
GGACGCGTTTGGCTCGTCTTAGTTTTTCTGGTGTCATTTTTTTTAAAAAAAACCAATATTTATAATATAGGTGTCGGTTTTGTTTAAAATCGGCTCCTAT

Reverse complement sequence

ATAGGAGCCGATTTTAAACAAAACCGACACCTATATTATAAATATTGGTTTTTTTTAAAAAAAATGACACCAGAAAAACTAAGACGAGCCAAACGCGTCC[C/T]
GTCCTTGTCCATACTCGCTCCCCACCCTACACAAAATCTCTCTCACTCTCGCTCTCTCTCACTCTCCCCCGCCCCTCCTCTCCCTCCGCCCCCTCATGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.00% 0.40% 0.00% NA
All Indica  2759 75.10% 24.50% 0.43% 0.00% NA
All Japonica  1512 6.90% 93.10% 0.07% 0.00% NA
Aus  269 90.30% 7.80% 1.86% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 63.20% 36.60% 0.22% 0.00% NA
Indica III  913 66.30% 32.90% 0.88% 0.00% NA
Indica Intermediate  786 75.40% 24.20% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 18.80% 81.00% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122694201 G -> A LOC_Os01g40220.1 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0122694201 G -> A LOC_Os01g40230.1 upstream_gene_variant ; 4220.0bp to feature; MODIFIER silent_mutation Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0122694201 G -> A LOC_Os01g40210.1 downstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0122694201 G -> A LOC_Os01g40210-LOC_Os01g40220 intergenic_region ; MODIFIER silent_mutation Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122694201 NA 1.52E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 8.20E-17 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 7.64E-06 1.96E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 4.25E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 8.81E-06 3.60E-06 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 1.82E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 9.50E-06 8.58E-07 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 7.43E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 5.51E-06 4.73E-07 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 1.27E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 3.45E-06 5.19E-06 mr1744 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201 NA 3.31E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251