\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122692993:

Variant ID: vg0122692993 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 22692993
Reference Allele: CAlternative Allele: T,CATCCATGTCGGCCGT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATGCATAGGATAGGATAATTATTACTGAGATGTGCACGAGATGTGCAGTGAGGTTCTTAGTGTCGATCAAAGCGATCGCCTCAGCCGTACGGCGCGG[C/T,CATCCATGTCGGCCGT]
GTCGTGCATGCCACGTCGCATATGACGGCGAGCCGCCTAGCCCGGTTAAGGAATCTCACAGCGGTGAGCGACATGTCAGAGAAAGATGGCGAGGTTGACT

Reverse complement sequence

AGTCAACCTCGCCATCTTTCTCTGACATGTCGCTCACCGCTGTGAGATTCCTTAACCGGGCTAGGCGGCTCGCCGTCATATGCGACGTGGCATGCACGAC[G/A,ACGGCCGACATGGATG]
CCGCGCCGTACGGCTGAGGCGATCGCTTTGATCGACACTAAGAACCTCACTGCACATCTCGTGCACATCTCAGTAATAATTATCCTATCCTATGCATGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 45.40% 0.23% 0.68% NA
All Indica  2759 75.60% 23.80% 0.14% 0.36% NA
All Japonica  1512 6.90% 93.00% 0.00% 0.07% NA
Aus  269 86.20% 5.60% 1.86% 6.32% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 63.70% 35.90% 0.22% 0.22% NA
Indica III  913 67.50% 32.10% 0.22% 0.22% NA
Indica Intermediate  786 75.40% 23.50% 0.13% 0.89% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 18.80% 81.00% 0.00% 0.20% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 13.50% 2.08% 3.12% NA
Intermediate  90 40.00% 58.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122692993 C -> T LOC_Os01g40200.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> T LOC_Os01g40210.1 upstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> T LOC_Os01g40220.1 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> T LOC_Os01g40200.2 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> T LOC_Os01g40200-LOC_Os01g40210 intergenic_region ; MODIFIER silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> DEL N N silent_mutation Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> CATCCATGTCGGCCGT LOC_Os01g40200.1 upstream_gene_variant ; 4950.0bp to feature; MODIFIER N Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> CATCCATGTCGGCCGT LOC_Os01g40210.1 upstream_gene_variant ; 72.0bp to feature; MODIFIER N Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> CATCCATGTCGGCCGT LOC_Os01g40220.1 upstream_gene_variant ; 2287.0bp to feature; MODIFIER N Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> CATCCATGTCGGCCGT LOC_Os01g40200.2 upstream_gene_variant ; 4950.0bp to feature; MODIFIER N Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0122692993 C -> CATCCATGTCGGCCGT LOC_Os01g40200-LOC_Os01g40210 intergenic_region ; MODIFIER N Average:72.519; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122692993 C CATCC* 0.06 -0.02 -0.02 0.07 0.13 0.17
vg0122692993 C T -0.04 -0.03 -0.03 -0.04 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122692993 NA 2.21E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.29E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 4.32E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 3.56E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 2.55E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.13E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 5.39E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 5.32E-06 5.28E-18 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 3.16E-06 8.05E-07 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 3.94E-06 3.09E-13 mr1325 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 3.92E-07 6.33E-07 mr1325 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.41E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 3.99E-06 NA mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 4.49E-15 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 2.65E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 3.75E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.66E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.01E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 7.39E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.55E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 6.48E-07 NA mr1630 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 7.76E-07 1.69E-07 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 2.94E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 4.44E-09 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 3.86E-06 NA mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 6.76E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 6.48E-06 NA mr1744 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 4.88E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 2.27E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 5.22E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.19E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.37E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.14E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 7.20E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 5.16E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.55E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.18E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.12E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 3.94E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 7.70E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.87E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 8.48E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 3.24E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 5.35E-10 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122692993 NA 1.75E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251