Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122682136:

Variant ID: vg0122682136 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22682136
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCAAATTTGAATCGGAAATATAAACTTTTGACTTATAAACTTTTGGTCTCTAAACTTTAGATGTGTAAACTTTAGGTGTATAAATTTACTAAAATAG[G/A]
AAAGTAATGTAGTGCCAAAAAAGGAAACCAGGTGGAGATGTGGAGGGAGGGAGGGGGGGCAAAATCTGATCGCCCTTCGCCCAGTAGCATTTCCGGCCTA

Reverse complement sequence

TAGGCCGGAAATGCTACTGGGCGAAGGGCGATCAGATTTTGCCCCCCCTCCCTCCCTCCACATCTCCACCTGGTTTCCTTTTTTGGCACTACATTACTTT[C/T]
CTATTTTAGTAAATTTATACACCTAAAGTTTACACATCTAAAGTTTAGAGACCAAAAGTTTATAAGTCAAAAGTTTATATTTCCGATTCAAATTTGAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	44.60%	0.23%	0.00%	NA
All Indica	2759	31.10%	68.60%	0.25%	0.00%	NA
All Japonica	1512	93.30%	6.60%	0.07%	0.00%	NA
Aus	269	67.70%	31.60%	0.74%	0.00%	NA
Indica I	595	2.40%	97.30%	0.34%	0.00%	NA
Indica II	465	40.20%	59.60%	0.22%	0.00%	NA
Indica III	913	44.20%	55.50%	0.22%	0.00%	NA
Indica Intermediate	786	32.20%	67.60%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.20%	18.70%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122682136	G -> A	LOC_Os01g40190.1	downstream_gene_variant ; 3515.0bp to feature; MODIFIER	silent_mutation	Average:43.338; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0122682136	G -> A	LOC_Os01g40200.1	downstream_gene_variant ; 1407.0bp to feature; MODIFIER	silent_mutation	Average:43.338; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0122682136	G -> A	LOC_Os01g40200.2	downstream_gene_variant ; 1407.0bp to feature; MODIFIER	silent_mutation	Average:43.338; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0122682136	G -> A	LOC_Os01g40190-LOC_Os01g40200	intergenic_region ; MODIFIER	silent_mutation	Average:43.338; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122682136	NA	1.21E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122682136	NA	2.78E-09	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122682136	NA	1.63E-07	mr1149_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122682136	NA	1.06E-07	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251