\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122636293:

Variant ID: vg0122636293 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22636293
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATGGAACATAGGCTTCCTTCGTTCCAGCTCCCTCCGCCTTGTTTTCCGCGCGCACGCTTCCTAAACTGCTAAACTGTGCGTTTTTTACAAAAATTTT[A/C,T]
TATACAAAAGTTGCTTACAAAAATCATATTGATCCATTTTTAAAAACAAATATCTAATACTTAATTAATCACGTGCTAATGGACTGTTCCGTTTTCCGTG

Reverse complement sequence

CACGGAAAACGGAACAGTCCATTAGCACGTGATTAATTAAGTATTAGATATTTGTTTTTAAAAATGGATCAATATGATTTTTGTAAGCAACTTTTGTATA[T/G,A]
AAAATTTTTGTAAAAAACGCACAGTTTAGCAGTTTAGGAAGCGTGCGCGCGGAAAACAAGGCGGAGGGAGCTGGAACGAAGGAAGCCTATGTTCCATCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 41.90% 0.02% 0.00% T: 1.95%
All Indica  2759 38.90% 61.00% 0.04% 0.00% NA
All Japonica  1512 93.30% 0.70% 0.00% 0.00% T: 5.95%
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 4.50% 95.30% 0.17% 0.00% NA
Indica II  465 43.20% 56.80% 0.00% 0.00% NA
Indica III  913 58.90% 41.10% 0.00% 0.00% NA
Indica Intermediate  786 39.20% 60.80% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 82.10% 0.60% 0.00% 0.00% T: 17.26%
Japonica Intermediate  241 96.70% 2.10% 0.00% 0.00% T: 1.24%
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122636293 A -> T LOC_Os01g40130.1 upstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N
vg0122636293 A -> T LOC_Os01g40140.1 downstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N
vg0122636293 A -> T LOC_Os01g40120.1 intron_variant ; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N
vg0122636293 A -> C LOC_Os01g40130.1 upstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N
vg0122636293 A -> C LOC_Os01g40140.1 downstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N
vg0122636293 A -> C LOC_Os01g40120.1 intron_variant ; MODIFIER silent_mutation Average:74.327; most accessible tissue: Callus, score: 89.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122636293 NA 5.78E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 3.20E-09 mr1870 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 9.02E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 1.19E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 9.86E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 4.67E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 5.83E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 1.28E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 7.59E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122636293 NA 1.30E-11 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251