\
| Variant ID: vg0122636293 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22636293 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 204. )
TTGATGGAACATAGGCTTCCTTCGTTCCAGCTCCCTCCGCCTTGTTTTCCGCGCGCACGCTTCCTAAACTGCTAAACTGTGCGTTTTTTACAAAAATTTT[A/C,T]
TATACAAAAGTTGCTTACAAAAATCATATTGATCCATTTTTAAAAACAAATATCTAATACTTAATTAATCACGTGCTAATGGACTGTTCCGTTTTCCGTG
CACGGAAAACGGAACAGTCCATTAGCACGTGATTAATTAAGTATTAGATATTTGTTTTTAAAAATGGATCAATATGATTTTTGTAAGCAACTTTTGTATA[T/G,A]
AAAATTTTTGTAAAAAACGCACAGTTTAGCAGTTTAGGAAGCGTGCGCGCGGAAAACAAGGCGGAGGGAGCTGGAACGAAGGAAGCCTATGTTCCATCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 41.90% | 0.02% | 0.00% | T: 1.95% |
| All Indica | 2759 | 38.90% | 61.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 93.30% | 0.70% | 0.00% | 0.00% | T: 5.95% |
| Aus | 269 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.50% | 95.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 43.20% | 56.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 39.20% | 60.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.10% | 0.60% | 0.00% | 0.00% | T: 17.26% |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 0.00% | 0.00% | T: 1.24% |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 0.00% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122636293 | A -> T | LOC_Os01g40130.1 | upstream_gene_variant ; 2950.0bp to feature; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| vg0122636293 | A -> T | LOC_Os01g40140.1 | downstream_gene_variant ; 4988.0bp to feature; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| vg0122636293 | A -> T | LOC_Os01g40120.1 | intron_variant ; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| vg0122636293 | A -> C | LOC_Os01g40130.1 | upstream_gene_variant ; 2950.0bp to feature; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| vg0122636293 | A -> C | LOC_Os01g40140.1 | downstream_gene_variant ; 4988.0bp to feature; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| vg0122636293 | A -> C | LOC_Os01g40120.1 | intron_variant ; MODIFIER | silent_mutation | Average:74.327; most accessible tissue: Callus, score: 89.192 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122636293 | NA | 5.78E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 3.20E-09 | mr1870 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 9.02E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 1.19E-06 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 9.86E-08 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 4.67E-10 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 5.83E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 1.28E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 7.59E-07 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122636293 | NA | 1.30E-11 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |