\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122564570:

Variant ID: vg0122564570 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22564570
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TACTTTATTGATTCTTTCTATGTTTACAAAGTGCACCGACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATT[A/G]
CTCTCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAGGAGTCCTAAA

Reverse complement sequence

TTTAGGACTCCTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGAGAG[T/C]
AATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTCGGTGCACTTTGTAAACATAGAAAGAATCAATAAAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.30% 0.38% 0.00% NA
All Indica  2759 53.00% 46.50% 0.51% 0.00% NA
All Japonica  1512 95.10% 4.90% 0.00% 0.00% NA
Aus  269 55.40% 44.20% 0.37% 0.00% NA
Indica I  595 5.90% 94.10% 0.00% 0.00% NA
Indica II  465 44.70% 54.40% 0.86% 0.00% NA
Indica III  913 84.90% 15.10% 0.00% 0.00% NA
Indica Intermediate  786 56.60% 42.10% 1.27% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 81.20% 1.04% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122564570 A -> G LOC_Os01g40000.1 upstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:29.051; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0122564570 A -> G LOC_Os01g40010.1 downstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:29.051; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0122564570 A -> G LOC_Os01g40000-LOC_Os01g40010 intergenic_region ; MODIFIER silent_mutation Average:29.051; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122564570 NA 1.19E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 4.62E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 8.34E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 8.81E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 3.65E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 5.23E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 8.28E-07 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 8.31E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 4.39E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 3.26E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 5.40E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 3.92E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 3.17E-12 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 2.52E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122564570 NA 1.21E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251