\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122469340:

Variant ID: vg0122469340 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22469340
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTTGAATTTATGGGGATTCACCAAACGGTAATAATTTATTTGAGTTAAAATATTTTTCATTTTACCCCCCGACAAAATAAACATGTGAGCTGTTGG[A/G]
TGTTTATCTAGTTATTGAAAAAAGTGAGTTAAAAATAAGAAGGAAAAACTGGATACCTGCTGAATAGGATGGTCCCTATGTGCTACATCATGTTTACCAA

Reverse complement sequence

TTGGTAAACATGATGTAGCACATAGGGACCATCCTATTCAGCAGGTATCCAGTTTTTCCTTCTTATTTTTAACTCACTTTTTTCAATAACTAGATAAACA[T/C]
CCAACAGCTCACATGTTTATTTTGTCGGGGGGTAAAATGAAAAATATTTTAACTCAAATAAATTATTACCGTTTGGTGAATCCCCATAAATTCAAAAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 8.70% 5.40% 0.00% NA
All Indica  2759 76.30% 14.60% 9.06% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.20% 15.00% 26.89% 0.00% NA
Indica II  465 50.50% 40.40% 9.03% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 77.70% 16.20% 6.11% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122469340 A -> G LOC_Os01g39840.1 downstream_gene_variant ; 3330.0bp to feature; MODIFIER silent_mutation Average:44.637; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0122469340 A -> G LOC_Os01g39840.2 downstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:44.637; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N
vg0122469340 A -> G LOC_Os01g39830.1 intron_variant ; MODIFIER silent_mutation Average:44.637; most accessible tissue: Zhenshan97 flower, score: 85.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122469340 NA 1.06E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0122469340 NA 9.17E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 1.99E-06 NA mr1962 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 5.51E-06 NA mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 1.34E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 3.19E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 6.84E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 1.88E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 7.04E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 3.29E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 1.97E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 9.78E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 4.72E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 4.54E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122469340 NA 1.97E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251