\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122460248:

Variant ID: vg0122460248 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22460248
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCAACAATGCACATGCAGAGTTTTTCCCTTTTTATTTCAGAAAGGGGCTTGCAACATTAATTTTGATAAGACAGAAAGGTAGAGCAAGCTAGTGAA[C/G]
TGAGAGGGGAGTATTTTATAGAAACACCCCGAAGTTTTCCGGTTGGCTCTACAAAATGATGGACTAGACGACCTGAGTTTGAAGTCTCACCCCTTTTAAT

Reverse complement sequence

ATTAAAAGGGGTGAGACTTCAAACTCAGGTCGTCTAGTCCATCATTTTGTAGAGCCAACCGGAAAACTTCGGGGTGTTTCTATAAAATACTCCCCTCTCA[G/C]
TTCACTAGCTTGCTCTACCTTTCTGTCTTATCAAAATTAATGTTGCAAGCCCCTTTCTGAAATAAAAAGGGAAAAACTCTGCATGTGCATTGTTGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 16.50% 0.28% 9.71% NA
All Indica  2759 74.30% 9.10% 0.33% 16.31% NA
All Japonica  1512 68.30% 31.50% 0.26% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 98.00% 1.30% 0.00% 0.67% NA
Indica II  465 63.20% 2.40% 0.65% 33.76% NA
Indica III  913 64.60% 17.60% 0.11% 17.63% NA
Indica Intermediate  786 74.00% 9.00% 0.64% 16.28% NA
Temperate Japonica  767 96.20% 3.70% 0.13% 0.00% NA
Tropical Japonica  504 23.60% 76.00% 0.40% 0.00% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 0.00% 2.08% NA
Intermediate  90 63.30% 28.90% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122460248 C -> G LOC_Os01g39820.1 upstream_gene_variant ; 3901.0bp to feature; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> G LOC_Os01g39810.1 downstream_gene_variant ; 4015.0bp to feature; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> G LOC_Os01g39810.2 downstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> G LOC_Os01g39810.4 downstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> G LOC_Os01g39810.3 downstream_gene_variant ; 4015.0bp to feature; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> G LOC_Os01g39820-LOC_Os01g39830 intergenic_region ; MODIFIER silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N
vg0122460248 C -> DEL N N silent_mutation Average:62.765; most accessible tissue: Callus, score: 75.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122460248 NA 9.07E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 4.13E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 2.42E-06 NA mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 1.49E-10 mr1194 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 6.07E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 1.64E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 2.72E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 2.33E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 4.42E-07 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 8.76E-06 NA mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.46E-09 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 5.76E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 6.67E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.74E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.85E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.69E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 1.02E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 5.92E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.30E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 5.64E-09 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.86E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 9.36E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 4.65E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 7.14E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 5.69E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 4.75E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 9.73E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.63E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 5.09E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 3.97E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122460248 NA 4.67E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251