| Variant ID: vg0122456656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22456656 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 94. )
TTATCAAAAACATCACATCGAATCTTTAGACACATATATGGAACATTAAATATAGATAAAAAGAAAAACCAATTGCACAGTTTGTATGTAAATCGCGAGA[C/T]
GAATCTTTTGAGCCTAATTAGGCCATGATTAGCCATAAGTGCTACGGTAACCCACACGTGTTAATGACGAATTAATTAGGTTCAAAAGATTCGTCTCGCG
CGCGAGACGAATCTTTTGAACCTAATTAATTCGTCATTAACACGTGTGGGTTACCGTAGCACTTATGGCTAATCATGGCCTAATTAGGCTCAAAAGATTC[G/A]
TCTCGCGATTTACATACAAACTGTGCAATTGGTTTTTCTTTTTATCTATATTTAATGTTCCATATATGTGTCTAAAGATTCGATGTGATGTTTTTGATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 41.10% | 1.59% | 8.44% | NA |
| All Indica | 2759 | 32.40% | 50.90% | 2.46% | 14.28% | NA |
| All Japonica | 1512 | 68.50% | 31.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 6.40% | 92.90% | 0.34% | 0.34% | NA |
| Indica II | 465 | 9.70% | 55.70% | 5.59% | 29.03% | NA |
| Indica III | 913 | 56.50% | 25.60% | 1.64% | 16.21% | NA |
| Indica Intermediate | 786 | 37.50% | 45.40% | 3.18% | 13.87% | NA |
| Temperate Japonica | 767 | 96.20% | 3.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 23.80% | 75.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 46.70% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122456656 | C -> T | LOC_Os01g39820.1 | upstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> T | LOC_Os01g39810.1 | downstream_gene_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> T | LOC_Os01g39810.2 | downstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> T | LOC_Os01g39810.4 | downstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> T | LOC_Os01g39810.3 | downstream_gene_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> T | LOC_Os01g39820-LOC_Os01g39830 | intergenic_region ; MODIFIER | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0122456656 | C -> DEL | N | N | silent_mutation | Average:33.554; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122456656 | NA | 3.30E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 2.98E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 1.27E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 5.14E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 4.12E-07 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 1.14E-09 | mr1359 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 2.83E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 2.03E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 1.83E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122456656 | NA | 4.44E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/