Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122451262:

Variant ID: vg0122451262 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22451262
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCCCCATGGTTCATGGTAACTATTTTTTGAATTCACGCCAAAAAATTCTTGTGTATTTCTCTGAATGAAGATTAGAAATGAAGCTTAGAGTTATAGGA[T/A]
TCTGGTTTGAGTCATGGTGTTAAGTCACATGTAAAAGAAATAGAAGTGCTCAGTATCAACAGTTTCTCATGTAACTAGATTCTTAGTTGGGAATTGATTG

Reverse complement sequence

CAATCAATTCCCAACTAAGAATCTAGTTACATGAGAAACTGTTGATACTGAGCACTTCTATTTCTTTTACATGTGACTTAACACCATGACTCAAACCAGA[A/T]
TCCTATAACTCTAAGCTTCATTTCTAATCTTCATTCAGAGAAATACACAAGAATTTTTTGGCGTGAATTCAAAAAATAGTTACCATGAACCATGGGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	9.00%	0.99%	0.42%	NA
All Indica	2759	82.50%	15.10%	1.70%	0.69%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	65.40%	30.10%	3.01%	1.51%	NA
Indica III	913	80.70%	17.60%	1.53%	0.11%	NA
Indica Intermediate	786	81.90%	14.40%	2.29%	1.40%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122451262	T -> A	LOC_Os01g39800.1	upstream_gene_variant ; 1443.0bp to feature; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39800.2	upstream_gene_variant ; 1470.0bp to feature; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39820.1	downstream_gene_variant ; 3878.0bp to feature; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39810.1	intron_variant ; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39810.2	intron_variant ; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39810.4	intron_variant ; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> A	LOC_Os01g39810.3	intron_variant ; MODIFIER	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N
vg0122451262	T -> DEL	N	N	silent_mutation	Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122451262	NA	1.16E-08	mr1291	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	8.95E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	3.38E-08	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	9.46E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	9.88E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	7.80E-06	mr1678	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	8.31E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262	NA	1.43E-07	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251