\
| Variant ID: vg0122451262 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22451262 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 130. )
ATTCCCCATGGTTCATGGTAACTATTTTTTGAATTCACGCCAAAAAATTCTTGTGTATTTCTCTGAATGAAGATTAGAAATGAAGCTTAGAGTTATAGGA[T/A]
TCTGGTTTGAGTCATGGTGTTAAGTCACATGTAAAAGAAATAGAAGTGCTCAGTATCAACAGTTTCTCATGTAACTAGATTCTTAGTTGGGAATTGATTG
CAATCAATTCCCAACTAAGAATCTAGTTACATGAGAAACTGTTGATACTGAGCACTTCTATTTCTTTTACATGTGACTTAACACCATGACTCAAACCAGA[A/T]
TCCTATAACTCTAAGCTTCATTTCTAATCTTCATTCAGAGAAATACACAAGAATTTTTTGGCGTGAATTCAAAAAATAGTTACCATGAACCATGGGGAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.60% | 9.00% | 0.99% | 0.42% | NA |
| All Indica | 2759 | 82.50% | 15.10% | 1.70% | 0.69% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 65.40% | 30.10% | 3.01% | 1.51% | NA |
| Indica III | 913 | 80.70% | 17.60% | 1.53% | 0.11% | NA |
| Indica Intermediate | 786 | 81.90% | 14.40% | 2.29% | 1.40% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122451262 | T -> A | LOC_Os01g39800.1 | upstream_gene_variant ; 1443.0bp to feature; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39800.2 | upstream_gene_variant ; 1470.0bp to feature; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39820.1 | downstream_gene_variant ; 3878.0bp to feature; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39810.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39810.2 | intron_variant ; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39810.4 | intron_variant ; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> A | LOC_Os01g39810.3 | intron_variant ; MODIFIER | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0122451262 | T -> DEL | N | N | silent_mutation | Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122451262 | NA | 1.16E-08 | mr1291 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 8.95E-07 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 3.38E-08 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 9.46E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 9.88E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 7.80E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 8.31E-06 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122451262 | NA | 1.43E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |