\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122451262:

Variant ID: vg0122451262 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22451262
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCCCATGGTTCATGGTAACTATTTTTTGAATTCACGCCAAAAAATTCTTGTGTATTTCTCTGAATGAAGATTAGAAATGAAGCTTAGAGTTATAGGA[T/A]
TCTGGTTTGAGTCATGGTGTTAAGTCACATGTAAAAGAAATAGAAGTGCTCAGTATCAACAGTTTCTCATGTAACTAGATTCTTAGTTGGGAATTGATTG

Reverse complement sequence

CAATCAATTCCCAACTAAGAATCTAGTTACATGAGAAACTGTTGATACTGAGCACTTCTATTTCTTTTACATGTGACTTAACACCATGACTCAAACCAGA[A/T]
TCCTATAACTCTAAGCTTCATTTCTAATCTTCATTCAGAGAAATACACAAGAATTTTTTGGCGTGAATTCAAAAAATAGTTACCATGAACCATGGGGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 9.00% 0.99% 0.42% NA
All Indica  2759 82.50% 15.10% 1.70% 0.69% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 65.40% 30.10% 3.01% 1.51% NA
Indica III  913 80.70% 17.60% 1.53% 0.11% NA
Indica Intermediate  786 81.90% 14.40% 2.29% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122451262 T -> A LOC_Os01g39800.1 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39800.2 upstream_gene_variant ; 1470.0bp to feature; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39820.1 downstream_gene_variant ; 3878.0bp to feature; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39810.1 intron_variant ; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39810.2 intron_variant ; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39810.4 intron_variant ; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> A LOC_Os01g39810.3 intron_variant ; MODIFIER silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0122451262 T -> DEL N N silent_mutation Average:66.076; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122451262 NA 1.16E-08 mr1291 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 8.95E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 3.38E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 9.46E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 9.88E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 7.80E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 8.31E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122451262 NA 1.43E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251