\
| Variant ID: vg0122441656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22441656 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGTTAAAACAACGAGAGGCCCTTAATTATTATATCGGAGTAACATAATCTTCTTCTCCTTTTCTTCCCCTTCTTTTCGTTGGCCAAAACATCATTGAAT[T/C]
ATATACACACAAAAAGAACGCCCTCTTGTCCGTCAGCTAGCAATCTAAACAATCCACGTTCAAGTAAAGAGGATGAATCCGGGAGGTAAAAGAAAAAAAG
CTTTTTTTCTTTTACCTCCCGGATTCATCCTCTTTACTTGAACGTGGATTGTTTAGATTGCTAGCTGACGGACAAGAGGGCGTTCTTTTTGTGTGTATAT[A/G]
ATTCAATGATGTTTTGGCCAACGAAAAGAAGGGGAAGAAAAGGAGAAGAAGATTATGTTACTCCGATATAATAATTAAGGGCCTCTCGTTGTTTTAACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 0.20% | 0.21% | 43.57% | NA |
| All Indica | 2759 | 40.40% | 0.30% | 0.36% | 58.90% | NA |
| All Japonica | 1512 | 94.80% | 0.10% | 0.00% | 5.09% | NA |
| Aus | 269 | 10.00% | 0.70% | 0.00% | 89.22% | NA |
| Indica I | 595 | 4.90% | 0.50% | 0.84% | 93.78% | NA |
| Indica II | 465 | 43.00% | 0.60% | 0.00% | 56.34% | NA |
| Indica III | 913 | 59.60% | 0.10% | 0.11% | 40.20% | NA |
| Indica Intermediate | 786 | 43.60% | 0.10% | 0.51% | 55.73% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 86.50% | 0.20% | 0.00% | 13.29% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 8.30% | 0.00% | 0.00% | 91.67% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122441656 | T -> DEL | N | N | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39790.2 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39790.2 | 5_prime_UTR_variant ; 243.0bp to feature; MODIFIER | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39780.1 | downstream_gene_variant ; 3264.0bp to feature; MODIFIER | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39800.1 | downstream_gene_variant ; 4615.0bp to feature; MODIFIER | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39800.2 | downstream_gene_variant ; 4554.0bp to feature; MODIFIER | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0122441656 | T -> C | LOC_Os01g39790.1 | intron_variant ; MODIFIER | silent_mutation | Average:73.386; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122441656 | NA | 4.03E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 2.38E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 1.15E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 2.03E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 5.58E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 9.69E-08 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 2.57E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | 7.92E-07 | NA | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | 9.07E-08 | 9.07E-08 | mr1875 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | 9.87E-08 | NA | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | 9.61E-07 | 2.85E-08 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 3.71E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 7.68E-10 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 1.02E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 2.06E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 7.15E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122441656 | NA | 1.28E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |