\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122438890:

Variant ID: vg0122438890 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22438890
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAATGTCTTAAGTTAAGTGGTGGAGTCATACATCTATCTCATATAAGCCAAAAAAGCTTCTCCAACCTAACTATTAAGTGGCTTATGGCTTCAAAAAA[G/A]
CCAAACGAAAAAGCTGCTTATTTGTTTAGACTTAGACTTTTTGGCTTATAAGTTGGCTTATAAGCCTAAACAAAGAGGGCCTAAGGTCGGTGATAGCTAC

Reverse complement sequence

GTAGCTATCACCGACCTTAGGCCCTCTTTGTTTAGGCTTATAAGCCAACTTATAAGCCAAAAAGTCTAAGTCTAAACAAATAAGCAGCTTTTTCGTTTGG[C/T]
TTTTTTGAAGCCATAAGCCACTTAATAGTTAGGTTGGAGAAGCTTTTTTGGCTTATATGAGATAGATGTATGACTCCACCACTTAACTTAAGACATTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 10.80% 0.78% 44.31% NA
All Indica  2759 18.60% 10.10% 1.09% 70.13% NA
All Japonica  1512 81.70% 13.10% 0.46% 4.70% NA
Aus  269 71.00% 7.40% 0.00% 21.56% NA
Indica I  595 1.20% 1.30% 1.01% 96.47% NA
Indica II  465 8.40% 1.90% 1.29% 88.39% NA
Indica III  913 34.90% 21.40% 1.20% 42.50% NA
Indica Intermediate  786 19.00% 8.70% 0.89% 71.50% NA
Temperate Japonica  767 99.20% 0.40% 0.26% 0.13% NA
Tropical Japonica  504 49.20% 36.90% 0.79% 13.10% NA
Japonica Intermediate  241 94.20% 3.70% 0.41% 1.66% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 56.70% 12.20% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122438890 G -> A LOC_Os01g39780.1 downstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:26.639; most accessible tissue: Callus, score: 45.255 N N N N
vg0122438890 G -> A LOC_Os01g39790.1 downstream_gene_variant ; 143.0bp to feature; MODIFIER silent_mutation Average:26.639; most accessible tissue: Callus, score: 45.255 N N N N
vg0122438890 G -> A LOC_Os01g39790.2 downstream_gene_variant ; 143.0bp to feature; MODIFIER silent_mutation Average:26.639; most accessible tissue: Callus, score: 45.255 N N N N
vg0122438890 G -> A LOC_Os01g39780-LOC_Os01g39790 intergenic_region ; MODIFIER silent_mutation Average:26.639; most accessible tissue: Callus, score: 45.255 N N N N
vg0122438890 G -> DEL N N silent_mutation Average:26.639; most accessible tissue: Callus, score: 45.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122438890 NA 1.93E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 NA 6.59E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.89E-08 NA mr1086 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 8.72E-06 5.73E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.12E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.60E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 4.55E-06 NA mr1155 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 4.45E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.66E-06 1.66E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 6.97E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 NA 4.97E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 7.12E-06 NA mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 NA 5.11E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 2.71E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.64E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 3.25E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 1.49E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 NA 2.23E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 9.02E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890 NA 8.53E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251