Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122438890:

Variant ID: vg0122438890 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22438890
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAATGTCTTAAGTTAAGTGGTGGAGTCATACATCTATCTCATATAAGCCAAAAAAGCTTCTCCAACCTAACTATTAAGTGGCTTATGGCTTCAAAAAA[G/A]
CCAAACGAAAAAGCTGCTTATTTGTTTAGACTTAGACTTTTTGGCTTATAAGTTGGCTTATAAGCCTAAACAAAGAGGGCCTAAGGTCGGTGATAGCTAC

Reverse complement sequence

GTAGCTATCACCGACCTTAGGCCCTCTTTGTTTAGGCTTATAAGCCAACTTATAAGCCAAAAAGTCTAAGTCTAAACAAATAAGCAGCTTTTTCGTTTGG[C/T]
TTTTTTGAAGCCATAAGCCACTTAATAGTTAGGTTGGAGAAGCTTTTTTGGCTTATATGAGATAGATGTATGACTCCACCACTTAACTTAAGACATTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.10%	10.80%	0.78%	44.31%	NA
All Indica	2759	18.60%	10.10%	1.09%	70.13%	NA
All Japonica	1512	81.70%	13.10%	0.46%	4.70%	NA
Aus	269	71.00%	7.40%	0.00%	21.56%	NA
Indica I	595	1.20%	1.30%	1.01%	96.47%	NA
Indica II	465	8.40%	1.90%	1.29%	88.39%	NA
Indica III	913	34.90%	21.40%	1.20%	42.50%	NA
Indica Intermediate	786	19.00%	8.70%	0.89%	71.50%	NA
Temperate Japonica	767	99.20%	0.40%	0.26%	0.13%	NA
Tropical Japonica	504	49.20%	36.90%	0.79%	13.10%	NA
Japonica Intermediate	241	94.20%	3.70%	0.41%	1.66%	NA
VI/Aromatic	96	95.80%	2.10%	0.00%	2.08%	NA
Intermediate	90	56.70%	12.20%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122438890	G -> A	LOC_Os01g39780.1	downstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:26.639; most accessible tissue: Callus, score: 45.255	N	N	N	N
vg0122438890	G -> A	LOC_Os01g39790.1	downstream_gene_variant ; 143.0bp to feature; MODIFIER	silent_mutation	Average:26.639; most accessible tissue: Callus, score: 45.255	N	N	N	N
vg0122438890	G -> A	LOC_Os01g39790.2	downstream_gene_variant ; 143.0bp to feature; MODIFIER	silent_mutation	Average:26.639; most accessible tissue: Callus, score: 45.255	N	N	N	N
vg0122438890	G -> A	LOC_Os01g39780-LOC_Os01g39790	intergenic_region ; MODIFIER	silent_mutation	Average:26.639; most accessible tissue: Callus, score: 45.255	N	N	N	N
vg0122438890	G -> DEL	N	N	silent_mutation	Average:26.639; most accessible tissue: Callus, score: 45.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122438890	NA	1.93E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	NA	6.59E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.89E-08	NA	mr1086	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	8.72E-06	5.73E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.12E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.60E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	4.55E-06	NA	mr1155	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	4.45E-06	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.66E-06	1.66E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	6.97E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	NA	4.97E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	7.12E-06	NA	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	NA	5.11E-06	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	2.71E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.64E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	3.25E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	1.49E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	NA	2.23E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	9.02E-06	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438890	NA	8.53E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251